Generation of human chronic wasting disease in transgenic mice
Published: 26 September 2021
Generation of human chronic wasting disease in transgenic mice
Zerui Wang, Kefeng Qin, Manuel V. Camacho, Ignazio Cali, Jue Yuan, Pingping Shen, Justin Greenlee, Qingzhong Kong, James A. Mastrianni & Wen-Quan Zou
Acta Neuropathologica Communications volume 9, Article number: 158 (2021) Cite this article
Abstract
Chronic wasting disease (CWD) is a cervid prion disease caused by the accumulation of an infectious misfolded conformer (PrPSc) of cellular prion protein (PrPC). It has been spreading rapidly in North America and also found in Asia and Europe. Although bovine spongiform encephalopathy (i.e. mad cow disease) is the only animal prion disease known to be zoonotic, the transmissibility of CWD to humans remains uncertain. Here we report the generation of the first CWD-derived infectious human PrPSc by elk CWD PrPSc-seeded conversion of PrPC in normal human brain homogenates using in vitro protein misfolding cyclic amplification (PMCA). Western blotting with human PrP selective antibody confirmed that the PMCA-generated protease-resistant PrPSc was derived from the human PrPC substrate. Two lines of humanized transgenic mice expressing human PrP with either Val or Met at the polymorphic codon 129 developed clinical prion disease following intracerebral inoculation with the PMCA-generated CWD-derived human PrPSc. Diseased mice exhibited distinct PrPSc patterns and neuropathological changes in the brain. Our study, using PMCA and animal bioassays, provides the first evidence that CWD PrPSc can cross the species barrier to convert human PrPC into infectious PrPSc that can produce bona fide prion disease when inoculated into humanized transgenic mice.
Introduction
Prion diseases are fatal transmissible spongiform encephalopathies of humans and animals characterized by the accumulation of the infectious prion protein (PrPSc) that is derived from its cellular isoform (PrPC) through a structural transition [32]. It is known that prion diseases are less transmissible across species because of species barrier associated largely with differences in each host’s PrP sequences [31]. However, bovine spongiform encephalopathy (BSE, commonly named mad cow disease) has been well-documented to cause variant Creutzfeldt-Jakob disease (vCJD) in humans [8, 13, 41], the first proven zoonotic prion disease. The outbreak of mad cow disease and its zoonotic transmissibility raise concerns about the potential public health threat from other animal-derived prion diseases.
Chronic wasting disease (CWD) is the most contagious of all prion diseases, and it is endemic in North America, having spread to 26 US states and 3 Canadian provinces. The disease has also been found in South Korea and most recently in Europe [6, 38]. The CWD prevalence rates among free-ranging cervids are as high as 40% in some areas of Colorado, Wyoming, and Wisconsin of the United States, where large amounts of venison are consumed [21, 30, 36]. Moreover, prions are readily shed from infected cervids through urine, feces, saliva, and carcasses. Prions in these excreta and bodies remain stable and infectious in the environment for many years. Thus, CWD poses potential risks to public health in North America. However, the zoonotic potential of CWD remains uncertain. On the one hand, there has been no published epidemiological evidence to support CWD transmissibility to humans. Published transmission studies so far have consistently failed to transmit the CWD agent to “humanized” transgenic (Tg) mice expressing human PrP [20, 23, 37]. Moreover, Race and co-workers have reported that the non-human primate Cynomolgus macaques were not susceptible to CWD [33,34,35]. On the other hand, Barria and co-workers observed that human PrPC from normal humanized transgenic (Tg) mouse brains could be converted by CWD PrPSc into proteinase K (PK)-resistant PrP (PrPres), albeit at low to moderate conversion efficiencies [3, 4]. In addition, squirrel monkeys have been found to be highly susceptible to CWD from white-tailed deer, mule deer, and elk after either intracerebral or oral challenges [3, 4, 27]. Furthermore, a recent international study observed an atypical phenotype in Cynomolgus macaques after challenge with CWD prions orally or intracerebrally: the affected animals showed minimal PrPSc in the CNS by immunohistochemistry staining and positive prion seeding activity by RT-QuIC and PMCA assays [14]. These conflicting experimental data and observations preclude a clear answer on whether CWD prions are zoonotic at this point. In order to demonstrate that CWD prions are zoonotic, it will be critical to search for direct evidence that CWD prions are capable of converting human brain PrPC into infectious PrPSc, that CWD prions can infect Tg mice expressing human PrP, and that ultimately the first cases of CWD transmissions to humans are identified. In addition, generation of experimental human CWD prions will also provide critical clues for the detection and diagnosis of acquired human CWD cases if and when they occur.
It is worth noting that the annual number of sporadic CJD (sCJD) cases in the USA has increased, with the total number of suspected and confirmed sCJD cases rising from 284 in 2003 to 511 in 2017 (https://www.cdc.gov/prions/cjd/occurrence-transmission.html). The greatly enhanced CJD surveillance and an aging population in the USA certainly contributed to the observed increase in annual sCJD case numbers in recent years, but the possibility cannot be excluded that some of the increased sCJD prevalence is linked to CWD exposure.
In the present study, using serial protein misfolding cyclic amplification (sPMCA) assay we generate PrPSc by seeding CWD prions in normal human brain homogenates. Importantly, we reveal that two lines of humanized Tg mice expressing human PrP-129VV and 129MM develop prion diseases upon intracerebral inoculation of the abnormal PrP generated by sPMCA. We believe that our study provides the first opportunity to dissect the clinical, pathological and biochemical features of the CWD-derived human prion disease in two lines of humanized Tg mice expressing two major human PrP genotypes, respectively.
Materials and methods
Reagents and antibodies
Proteinase K (PK) was purchased from Sigma Chemical Co. (St. Louis, MO). Reagents for enhanced chemiluminescence (ECL Plus) were from GE Healthcare. Anti-PrP antibody 3F4 against human PrP residues 107–112 [18, 45] and horseradish peroxidase-conjugated sheep anti-mouse IgG were purchased from Millipore Sigma (Burlington, MA).
Preparation of brain samples
Frozen non-CJD human brain tissues with PrPC-129MM or PrPC-129VV were collected at autopsy and maintained at -80 °C until used as substrates in PMCA. Brain tissues from uninfected humanized TgMM or TgVV, cervidized TgDeer (kindly provided by Glenn Telling, Ph.D., Colorado State University), or hamsters were also used as substrates in serial PMCA as controls. The samples were rinsed with PBS three times to avoid blood contamination before homogenization. For sequencing of the functional cervid PrP genes, genomic DNA was purified from frozen cervid brain tissues using standard phenol–chloroform extraction, and the coding region from the PrP genes was amplified by PCR using DePrP223 (ACACCCTC-TTTATTTTGCAG) and DePrP224 (AGAAGATAATGAAAACAGGAAG) primers. The PCR products were cloned into pstBlue-1. Purified PCR product and multiple clones from each cervid DNA sample were subjected to sequencing by MCLAB (South San Francisco, CA, USA) using the same primers. The elk samples came from elk with different PRNP genotypes: #1, #2, #3, and #4 (CWD-negative) were PrP-132MM; #5, #6 and #7 were PrP-132ML; and #8 was PrP-132LL. The genotype of the deer CWD (dCWD) isolate #9 was not available. Elk samples #1 through #7 and deer sample #9 were from captive animals in the terminal stages of disease and originated from the western United States. Elk sample #8 was from an elk with the PrP-132LL genotype that was experimentally inoculated with brain homogenate from a farmed elk of the same genotype.
Brain tissues were homogenized with a mini-Beads Beater in conversion buffer containing 150 mM NaCl, 1% Triton X-100, 8 mM EDTA and a complete protease inhibitor in PBS without Ca2+ and Mg2+ for a 10% brain homogenate. The samples were then centrifuged at 500 g for 5 min. The supernatant (S1) was transferred to a clean tube for future use. Brain homogenates (10%, weight/volume) from elk (n = 7, #1-#3, #5-#8) and deer (n = 1, #9) with CWD or non-CWD (n = 1, #4) were prepared as PMCA seeds in 1 × lysis buffer containing [10 mM Tris–HCl, 150 mM NaCl, 0.5% Nonidet P-40 (NP-40), 0.5% deoxycholate, 5 mM ethylenediaminetetraacetic acid (EDTA), pH 7.4]. For prion-infected mouse brain tissues, 10% brain homogenates were prepared in 1 × lysis buffer and the brain homogenates were treated with designated amounts of PK prior to Western blotting probing with 3F4. To prepare the detergent-soluble (S2) and detergent-insoluble (P2) fractions, the PMCA products or 10% normal brain homogenate (substrate, in conversion buffer) were mixed with an equal volume of 2 × lysis buffer and then subjected to ultracentrifugation at 100,000 g for 1 h at 4 °C. The supernatant was transferred into a clean tube as the S2, whereas the pellet was resuspended in 1 × lysis buffer as the P2 at the volume equal to that of S2.
Protein misfolding cyclic amplification (PMCA)
The preparation of PrP seeds and substrates, as well as PMCA, were conducted as previously described [11, 40] and above. Each seed was diluted in the substrate at a ratio of 1:100 (1 µL seeds + 99 µL substrates containing 50 µg/mL heparin) into a 200 µL PCR tube with 1 PTFE beads (diameter 3/32’’) (Teflon, APT, RI). 20 µL of each mixture was taken and kept at − 20 °C as a non-PMCA control. The remaining mixture was subjected to serial PMCA (sPMCA). Each cycle was comprised of a 20 s elapse time of sonication at amplitude 85 (250 watts; Misonix S3000 sonicator) followed by an incubation period of 29 min 40 s at 37 °C. Each round of sPMCA consisted of 96 cycles. For subsequent sPMCA rounds, 10 µL sample was taken from the last cycle of the immediate preceding round and placed into 90 µL fresh normal brain substrates to start a new round of amplifications.
Prion-inoculation and monitoring of humanized transgenic mice
Two lines of humanized transgenic mice were used in this study for assessing the infectivity of the PMCA-induced CWD-derived human PrPSc. Humanized TgMM (also named Tg40h) and TgVV (also termed Tg1307, derived from Tg152) mice expressing wild-type human PrP carrying either 129 M or 129 V polymorphism without endogenous mouse PrP as previously described [20, 42] were used in this study. The PMCA product seeded by #6 CWD prion isolate was diluted into 1% human brain homogenate in 1 × PBS before inoculation. After anesthetization of Tg mice with isoflurane, 30 µL of the diluted PMCA product was injected intracerebrally into each mouse with a 26-gauge needle as described previously [20, 42]. After intracerebral inoculations, the animals were monitored at least 3 times per week for symptoms such as coarse coat, waddling gait, hunched back, tail plasticity, and bradykinesia. Within 2–3 d days after presentation of clear symptoms or at death, the brain was removed and one-half brain was frozen for Western blotting of PrPSc, and the other half was fixed in formalin for histology and immunohistochemistry analysis as described below.
Western blotting
PMCA brain samples were subjected to treatment with PK at 100 µg/mL for 70 min at 45 °C with agitation prior to Western blotting. Samples were resolved on 15% Tris–HCl Criterion pre-cast gels (Bio-Rad) for SDS-PAGE as described previously [44]. The proteins on the gels were transferred to Immobilon-P membrane polyvinylidene fluoride membrane (PVDF, Millipore) for 2 h at 350 mA. For probing of PrP, the membranes were incubated for 2 h at room temperature with anti-PrP antibody 3F4 at 1:40,000 as the primary antibody. Following incubation with horseradish peroxidase-conjugated sheep anti-mouse IgG at 1:5,000, the PrP bands were visualized on Kodak film (Millipore Sigma) by ECL Plus as described by the manufacturer (GE Healthcare). For detection of the PK-resistant PrPSc in the frozen brain tissues of infected Tg mice, 50 µg/mL of PK or designated amounts of PK were used as indicated in each experiment at 37 °C for 1 h.
Histology, immunohistochemistry and lesion profiles
Histological and immunohistochemical evaluations were carried out on sagittal brain levels at approximately 3.12 mm and 1.56 mm to the midline as previously described [9, 40]. Paraffin-embedded sections were stained with hematoxylin–eosin (H&E) or immunohistochemistry (IHC) probed with the 3F4 antibody at 1:1,500 dilution, 10% GVM and then processed with the DAB detection kit as described by the manufacturer. Lesion profiles were generated following semi-quantitative evaluation of spongiform degeneration (SD) severity, which was rated on a 0 to 3 scale on H&E-stained Sects. (0: not detectable; 1: mild, 2: moderate, and 3: severe). The eight brain regions examined included the cerebral cortex (CC), hippocampus (HI), basal ganglia (BG), thalamus (TH), dorsal (d) and ventral (v) midbrain (MB), inferior brainstem (BS.i), and cerebellum (CE).
Statistical analysis
The differences in incubation times between TgVV and TgMM mice inoculated with sPMCA-induced CWD-derived human PrPSc as well as differences in lesion severity between different mice were statistically analyzed using Student’s T-test to obtain p values for comparisons between two groups.
Results
Generation of CWD-derived human PrPSc by PMCA
To determine whether CWD prions from affected cervid animal brains can convert PrPC from the normal human brain into PrPSc, we conducted protein misfolding cyclic amplification (PMCA) assays. These PMCA assays used brain homogenates of 3 individual CWD elk (CWD prion isolates #1, #2, or #3) as the prion seeds and brain homogenates from three non-CJD subjects as the substrates, respectively. These non-CJD subjects included two cases homozygous for methionine (M) at polymorphic codon 129 of the PrP gene (PrP-129MM) termed MM#1 and MM#2, and a case homozygous for valine (V) at codon 129 (PrP-129VV) designated VV#1. After 1 round of PMCA, Western blotting showed PrPres in 2 of 3 PMCA products seeded with CWD brain homogenates elk #1 and #2, but not elk #3 or the negative control elk #4, with the VV#1 substrate but not the MM#1 or MM#2 substrates (Fig. 1a). Since we used the anti-PrP monoclonal antibody 3F4 that is specific for human PrP but not cervid PrP as shown in Additional file 1: Fig. S1, we conclude that all detected PK-resistant PrP is exclusively human PrPres instead of cervid PrPSc, excluding the possibility that the detected PK-resistant PrPres in the PMCA products could be the CWD PrPSc seeds themselves rather than newly-converted PrPres from human PrPC.
To rule out the possibility that the detected PrPres was de novo PrPres generated from the PrPC substrate itself by PMCA, we conducted serial PMCA (sPMCA) with normal brain homogenates in the absence of CWD PrPSc seeds (Additional file 1: Fig. S2). No PrPres was detected in MM#1 and VV#1 after 12 rounds of sPMCA while it was detected in MM#2 after 6 or more rounds and in VV#2 after 9 or more rounds of sPMCA (Additional file 1: Fig. S2a, c, d). TgVV mouse brain homogenates showed no de novo PrPres generation after 12 rounds while TgMM was observed to generate de novo PrPres after 3 or more rounds of sPMCA (Additional file 1: Fig. S2b, c, d). In addition, normal hamster brain homogenates showed generation of de novo PrPres after 6 or more rounds of sPMCA (Additional file 1: Fig. S1c) and no de novo PrPres was found in TgDeer brain homogenates after 4 rounds of sPMCA (Additional file 1: Fig. S2b).
Using the same PMCA approach, we further examined the convertibility of human brain PrPC-129VV (VV#2) by PrPSc from 7 CWD cases that were composed of 6 CWD elks (#1, #2, #5-#8) and 1 CWD deer (#9). The PMCA assays were performed with two sonicators (S1 and S2) for comparison and duplication. We observed that PrPSc from all but one CWD elk isolate (#8) was able to convert human brain PrPC-129VV into PrPres after one round of PMCA, as evidenced by the 3F4-detected PrPres in the PMCA products (Fig. 1b). PrPSc from the CWD deer was also able to convert human brain PrPC into PrPres but the efficiency was lower compared to that of CWD elk (Fig. 1b). Moreover, the sPMCA-generated CWD-derived human PrPSc (Cd-HuPrPres) was consistently amplified until round 7 that showed a decrease in the amplification efficiency in both CWD isolates examined (Additional file 1: Fig. S3). Taken together, the results indicate that most of CWD prion isolates examined in this study were able to convert human PrPC-129 V but not human PrPC-129 M to generate Cd-HuPrPres by PMCA in vitro, suggesting a possible polymorphism preference.
Examination of infectivity of CWD-derived human PrPSc by animal transmission assay
Next we intracerebrally inoculated the Cd-HuPrPres (from the fourth round PMCA seeded the CWD elk #6 PrPSc seeds in the PrPC substrate from the normal human brain homogenate of case VV#1) into humanized Tg mice. Two mouse lines were inoculated: one expressing wild-type human PrP-129VV (TgVV) or human PrP-129MM (TgMM, previously termed Tg40h) [20, 26]. All 15 TgVV mice inoculated intracerebrally with Cd-HuPrPres developed disease at an average of 233 ± 6 (standard error, SE) days post inoculation (dpi) (range, 195 to 282 dpi) (Fig. 2). All 9 inoculated TgMM mice developed disease at an average of 552 ± 27 dpi (range, 413 to 645 dpi), a significantly longer incubation time than that of inoculated TgVV mice (p < 0.00001) (Fig. 2). This is not unexpected since the Cd-HuPrPres was generated from the human VV#1 case and prior evidence supports that matching residue 129 between PrPSc and PrPC facilitates prion propagation [19, 26].
Brains of inoculated Tg mice were examined by western blotting and neurohistology for evidence of PrPSc deposition and spongiform degeneration. We compared the electrophoretic gel profiles of PrPres from both Tg mouse lines inoculated with Cd-HuPrPres after treatment of brain homogenates with a range of PK concentrations (0, 5, 25, 50, or 100 µg/mL). Interestingly, the gel mobility of PrPres from the two lines of infected animals was different, in that TgVV displayed type 2-like PrPres and TgMM exhibited type 1-like PrPres; however, the ratio of the diglycosylated to non-glycosylated PrPres species was significantly higher in Cd-HuPrPres-infected TgMM and TgVV mice (Fig. 3, Additional file 1: Fig. S4), when compared to their sCJD counterparts PrPres type 1 [9] [2.9 (n = 5) vs. 0.6 (n = 3), p < 0.001] and PrPres type 2 [42] [2.1 (n = 7) vs 0.1 (n = 3), p < 0.001] (Additional file 1: Fig. S4).
The major histopathological differences between the two lines of inoculated mice were the significantly more severe cortical spongiform degeneration (SD) and the presence of plaque deposits in TgVV mice, compared with TgMM mice (Fig. 4a, b). The plaques were visualized on hematoxylin–eosin stained slides and confirmed to be composed of PrP by IHC staining with anti-PrP antibody 3F4 (Fig. 4a). Notably, occasional plaques were surrounded by vacuoles (Fig. 4a and Additional file 1: Fig. S5), resembling the florid plaques of CWD-affected cervids [24]. IHC staining also revealed granular PrPSc deposits that co-distributed with SD. Unlike TgVV mice, TgMM mice were free of plaque-like deposits in the cerebral cortex (CC). Lesion profiling showed similar SD distributions in the two groups of mice, except for the sparse presence of vacuoles in the cerebral cortex and overall less severe SD in the TgMM mice (Fig. 4c). Among the diseased TgVV mice, more severe lesions were found in animals bearing plaques than in those that were free of plaques (Fig. 4d). Moreover, in comparison with mice expressing matched PrP codon 129 genotypes but inoculated with sCJD prions [9, 42], the Cd-HuPrPres-infected TgVV and TgMM mice showed distinctive histopathological features. These features included (1) the presence of plaques reminiscent of CWD-florid plaques in some Cd-HuPrPres-infected TgVV mice; (2) seemingly more severe cortical spongiosis in Cd-HuPrPres-infected TgVV mice than in sCJDVV2-infected TgVV mice [9]; (3) lack of PrP plaques in our Cd-HuPrPres-infected TgMM mice but not in sCJDVV2-infected TgMM mice [9]; and (4) quite distinct lesion profiles between Cd-HuPrPres-infected TgMM mice and sCJDMM1-infected TgMM mice [42]. These data demonstrate that Cd-HuPrPres is infectious and capable of inducing bona fide prion diseases in mice. We will term it as “Cd-HuPrPSc” from here on.
It is conceivable that the sPMCA-generated infectivity in the above experiments could have resulted from de novo generation of PK-sensitive prions produced by sPMCA from the normal human brain homogenate VV#1 substrate rather than from CWD-seeded human PrP conversion. To rule out this possibility, we determined whether sPMCA induced an increase in the level of the insoluble PrP compared to that of normal brain homogenate substrate without PMCA treatment. We found that 4 rounds of sPMCA in the absence of CWD seeds actually led to a slight decrease of insoluble PrP in the P2 fraction and no detectable PK-resistant PrPSc (Additional file 1: Fig. S6), strongly suggesting that the observed infectivity of CWD-seeded sPMCA products in humanized mice was highly unlikely to be due to de novo generation of PK-sensitive PrPSc.
Discussion
Our current study has made the following findings. First, PMCA reveals that elk or deer CWD prions are able to overcome species barrier directly converting human brain PrPC carrying 129 V but not 129 M polymorphism into PrPSc in vitro. Second, the PMCA-induced CWD-derived human PrPSc conformer (Cd-HuPrPSc) is infectious, as it induced clinical prion disease in two lines of humanized Tg mice expressing human PrP with either 129 V or 129 M. Finally, PrPSc in brains of the diseased humanized Tg mice exhibits the electrophoretic mobility similar to those of sCJDMM1 or sCJDVV2 subtype, but the PrPSc glycoform ratios and neuropathological patterns are different. Histopathologically, the Cd-HuPrPSc-infected TgVV and TgMM mice showed some distinctive features when compared to the Tg mice expressing the matched 129 genotypes but inoculated with sCJDMM1 or sCJDVV2 prions [9, 42]. Our findings raise several important issues and implications as to the potential transmissibility of CWD to humans involving effects of seeds and substrates on transmissibility as well as clinical phenotypes of human CWD and traits of CWD-derived human prion strains.
PMCA has been used not only for detection of small amounts of PrPSc in peripheral tissues and various body fluids of suspected prion-infected individuals but also for generation of new PrPSc [11, 12, 15, 39, 40], Moreover, it has been applied to explore the potential for cross-species conversion of PrPC to PrPres as a way to assess the susceptibility of human PrPC to animal prion strains including CWD prions [2, 10, 17, 22]. Using PMCA, an earlier study revealed that wild-type human PrPC-129MM from humanized Tg mice was converted into human PrPres, but only after the CWD prion isolate had been stabilized by successive passages in cervid brain homogenates [4]. Moreover, the newly-generated PrPres had unique biochemical properties with a glycoform pattern similar to CWD seeds but slower migration compared to the seeds. Subsequently, Barria et al. observed that elk CWD prions could convert PrPC from human brain, humanized Tg mouse brain and cultured mammalian cells [2]. They also observed that the efficiency of in vitro cell-free human PrP conversion by cervid CWD prions was influenced by the PrP polymorphism at residue 129 in humans and its equivalent (residue 132) in cervids [3]. However, another study observed that mule deer PrPSc was unable to convert human PrPC from humanized Tg mouse brain homogenates [23].
PMCA under properly optimized conditions has been believed to faithfully amplify prions from different species in vitro [29]. The parental prion seed strain traits have been observed to remain in the PMCA amplified prion products [11]. PMCA has become a useful approach to address fundamental questions about prion biology in vitro such as the molecular basis of the seeding activity, some aspects of species barrier and prion strain adaptation, and the role of cofactors on prion replication. It has been also used to assess the zoonotic potential of animal prion diseases such as BSE, scrapie, CWD, and atypical prion diseases. For instance, studies have confirmed that PMCA exhibits species specificity that faithfully reflects the same transmission barrier observed in animals in vivo [1, 10, 16, 28]. When BSE and scrapie were examined for their capability to convert human PrP with the three major polymorphic variants (PRNP codon 129 MM, MV and VV) expressed in the humanized transgenic mouse brain [5, 17], cattle BSE prions was able to trigger the efficient conversion of human PrP with a preference similar to that of human vCJD (MM > MV > VV) while scrapie failed to convert the human substrates [17]. These results suggest that PMCA can faithfully replicate aspects of cross-species transmission potential and might provide useful additional information concerning the molecular barrier to zoonotic transmission. Therefore, although in vitro seeded PrPSc amplification by PMCA may not mimic all aspects of in vivo conversion of brain PrPC into PrPSc, our finding of the CWD-induced conversion of human brain PrPC into PrPSc suggests the potential of transmission of CWD to humans. It may also provide a model to dissect the mechanisms or factors that may be involved in the potential conversion of human PrPC into PrPSc by the CWD prions.
The new Cd-HuPrPSc generated by seeding CWD isolates in human PrPC-129VV exhibits a PrP electrophoretic profile similar to that of the CWD PrPSc seeds that are observed to exhibit a more pronounced di-glycosylated PrP glycoform but an underrepresented unglycosylated PrP migrating at ~ 21 kDa [43]. Interestingly, it remains as the PrPSc type 1-like form when it is inoculated into the humanized TgMM mice, whereas it switches into the PrPSc type 2-like form when it is inoculated into the humanized TgVV mice. This phenomenon is consistent with the previous findings that PrPSc type 2 was only detected in Tg mice expressing human PrP-129 V inoculated with PrPSc sCJDMV2 or sCJDVV2 while only PrPSc type 1 was detected in mice homozygous or heterozygous for Met at residue 129 regardless of inoculated PrPSc types [7]. Moreover, PrPC-129MM substrates from two individual non-CJD human brain samples were not able to be converted by CWD prions in PMCA reactions, which contrasts with the observations of Barria et al. [2]. One possible explanation is that there are other co-factors or inhibitors affecting the PrP convertibility in the brain tissues of some subjects. This is consistent with the observations that although millions of people are believed to have been exposed to BSE-contaminated products in the European countries, especially in the UK, there were only about 229 vCJD cases reported worldwide as of 2015 [25]. It will be interesting to determine the convertibility of brain PrPC from more normal human subjects including all three PrP genotypes (129MM, 129VV and 129MV).
The conversion efficiency varied between CWD prion isolates. Of the eight CWD isolates tested in this study, the seeding efficiency of #5 and #2 were the highest, followed by #6 and #1, then #7, #9, and the lowest were #8 and #3. Notably, match or mismatch between residue 129 of the human PrP substrate and residue 132 of the elk PrPSc seeds has been observed to affect the conversion efficiency in PMCA [3]. It will be important to further characterize the effect of different polymorphisms in CWD prion seeds and human PrPC substrates on the conversion efficiency. Except for the difference in conversion efficiency, no other significant differences were detected in the electrophoretic gel profile of Cd-HuPrPSc derived from different CWD isolates.
Although our study clearly shows that CWD prions are capable of converting human PrPC into infectious PrPSc in vitro, the real-world implications are less clear due to several factors. First, the CWD-induced conversion of human PrPC into PrPSc was facilitated by repeated rounds of sonication in the PMCA procedure, which is unnatural. Second, in vivo prion clearing and selection mechanisms do not exist in the PMCA reactions, potentially making it easier for the newly converted PrPSc (including those that may be normally selected against in vivo) to persist and amplify in vitro. This could lead to the generation of PrPSc that is different from PrPSc generated in humanized mice after direct inoculation with brain homogenate from a CWD infected deer. Third, the PMCA substrates were derived from brain homogenates of only 4 non-CJD cases with PrP-129MM or -129VV. Finally, only a few CWD isolates from a limited number of cervid PRNP genotypes were examined. This makes it difficult to draw conclusions on the impact that other CWD strains and PRNP polymorphisms may have on the ability to convert human PrPC. More research will be needed to address these limitations.
In summary, our study demonstrates that CWD prions are able to cross the species barrier to convert human brain PrPC into infectious PrPSc in vitro. Although the Cd-HuPrPSc largely retains the glycoform pattern of the CWD prion seeds, they produced type 1 PrPres in the TgMM mice and type 2 PrPres in the TgVV mice, but with distinct PrPSc glycoform ratios and histopathological features. We believe that our findings establish a new venue to study the likely molecular and neuropathological features of potential acquired human CWD cases, which may provide critical clues for identification of the first human cases of CWD infection should they occur.
Availability of data and material
All materials used in this study will be made available subject to a material transfer agreement.
References
snip...end
Research Project: Pathobiology, Genetics, and Detection of Transmissible Spongiform Encephalopathies Location: Virus and Prion Research
Title: Generation of human chronic wasting disease in transgenic mice
Author
item WANG, ZERUI - Case Western Reserve University (CWRU) item QIN, KEFENG - University Of Chicago item CAMACHO, MANUEL - Case Western Reserve University (CWRU) item SHEN, PINGPING - Case Western Reserve University (CWRU) item YUAN, JUE - Case Western Reserve University (CWRU) item Greenlee, Justin item CUI, LI - Jilin University item KONG, QINGZHONG - Case Western Reserve University (CWRU) item MASTRIANNI, JAMES - University Of Chicago item ZOU, WEN-QUAN - Case Western Reserve University (CWRU)
Submitted to: Acta Neuropathologica
Publication Type: Peer Reviewed Journal Publication Acceptance Date: 9/8/2021
Publication Date: N/A
Citation: N/A
Interpretive Summary: Prion diseases are invariably fatal neurologic diseases for which there is no known prevention or cure. Chronic wasting disease (CWD) is the prion disease of deer and elk and is present in farmed and free ranging herds throughout North America. To date there is no clear evidence that the CWD agent could be transmitted to humans. This manuscript describes the use of an in vitro technique, cell-free serial protein misfolding cyclic amplification (sPMCA), to generate a CWD prion that is infectious to transgenic mice expressing the human prion protein. This study provides the first evidence that CWD prions may be able to cause misfolding in the human prion protein. This information will impact medical experts and those involved in making policy for farmed cervids and wildlife.
Technical Abstract: Chronic wasting disease (CWD) is a cervid spongiform encephalopathy or prion disease caused by the infectious prion or PrPSc, a misfolded conformer of cellular prion protein (PrPC). It has rapidly spread in North America and also has been found in Asia and Europe. In contrast to the zoonotic mad cow disease that is the first animal prion disease found transmissible to humans, the transmissibility of CWD to humans remains uncertain although most previous studies have suggested that humans may not be susceptible to CWD. Here we report the generation of an infectious human PrPSc by seeding CWD PrPSc in normal human brain PrPC through the in vitro cell-free serial protein misfolding cyclic amplification (sPMCA). Western blotting confirms that the sPMCA-induced proteinase K-resistant PrPSc is a human form, evidenced by a PrP-specific antibody that recognizes human but not cervid PrP. Remarkably, two lines of humanized transgenic (Tg) mice expressing human PrP-129Val/Val (VV) or -129Met/Met (MM) polymorphism develop prion disease at 233 ± 6 (mean ± SE) days post-inoculation (dpi) and 552 ± 27 dpi, respectively, upon intracerebral inoculation with the sPMCA-generated PrPSc. The brain of diseased Tg mice reveals the electrophoretic profile of PrPSc similar to sporadic Creutzfeldt-Jakob disease (sCJD) MM1 or VV2 subtype but different neuropathological patterns. We believe that our study provides the first evidence that CWD PrPSc is able to convert human PrPC into PrPSc in vitro and the CWD-derived human PrPSc mimics atypical sCJD subtypes in humanized Tg mice.
''The brain of diseased Tg mice reveals the electrophoretic profile of PrPSc similar to sporadic Creutzfeldt-Jakob disease (sCJD) MM1 or VV2 subtype but different neuropathological patterns. We believe that our study provides the first evidence that CWD PrPSc is able to convert human PrPC into PrPSc in vitro and the CWD-derived human PrPSc mimics atypical sCJD subtypes in humanized Tg mice.''
Chronic wasting disease: a cervid prion infection looming to spillover
Alicia Otero 1 2 3, Camilo Duque Velásquez 1 2, Judd Aiken 2 4, Debbie McKenzie 5 6
Affiliations expand
PMID: 34488900 DOI: 10.1186/s13567-021-00986-y
***> CHRONIC WASTING DISEASE TSE PRP HUMANS ZOONOSIS ZOONOTIC <***
i thought i might share some news about cwd zoonosis that i got, that i cannot share or post to the public yet, i promised for various reasons, one that it will cause a shit storm for sure, but it was something i really already knew from previous studies, but, i was told that ;
==================
The contents of this e-mail message and any attachments are confidential and are intended solely for the addressee(s). The information may also be legally privileged. This transmission is sent in trust, for the sole purpose of delivery to the intended recipient(s). If you have received this transmission in error, any use, reproduction or dissemination of this transmission is strictly prohibited. If you are not the intended recipient, please immediately notify the sender by reply e-mail or phone and delete this message and its attachments, if any.
https://www.nature.com/articles/srep11573
PRION 2016 TOKYO
Saturday, April 23, 2016
SCRAPIE WS-01: Prion diseases in animals and zoonotic potential 2016
Prion. 10:S15-S21. 2016 ISSN: 1933-6896 printl 1933-690X online
Taylor & Francis
Prion 2016 Animal Prion Disease Workshop Abstracts
WS-01: Prion diseases in animals and zoonotic potential
Transmission of the different scrapie isolates in these mice leads to the emergence of prion strain phenotypes that showed similar characteristics to those displayed by MM1 or VV2 sCJD prion.
These results demonstrate that scrapie prions have a zoonotic potential and raise new questions about the possible link between animal and human prions.
http://www.tandfonline.com/doi/abs/10.1080/19336896.2016.1163048?journalCode=kprn20
Title: Transmission of scrapie prions to primate after an extended silent incubation period)
*** In complement to the recent demonstration that humanized mice are susceptible to scrapie, we report here the first observation of direct transmission of a natural classical scrapie isolate to a macaque after a 10-year incubation period. Neuropathologic examination revealed all of the features of a prion disease: spongiform change, neuronal loss, and accumulation of PrPres throughout the CNS.
*** This observation strengthens the questioning of the harmlessness of scrapie to humans, at a time when protective measures for human and animal health are being dismantled and reduced as c-BSE is considered controlled and being eradicated.
*** Our results underscore the importance of precautionary and protective measures and the necessity for long-term experimental transmission studies to assess the zoonotic potential of other animal prion strains.
http://www.ars.usda.gov/research/publications/publications.htm?SEQ_NO_115=313160
''As you can imagine, 2 and 5 (especially 5) may raise alarms. The evidence we have for 4 are not as strong or tight as I would like to have. At this point, please do not post any of the points publicly yet, but you can refer to points 1-3 in private discussions and all 5 points when discussing with relevant public officials to highlight the long-term risks of CWD zoonosis.''
====================
so, i figure your as about as official as it gets, and i think this science is extremely important for you to know and to converse about with your officials. it's about to burn a whole in my pocket. this is about as close as it will ever get for cwd zoonosis to be proven in my time, this and what Canada Czub et al found with the Macaques, plus an old study from cjd surveillance unit back that showed cjd and a 9% increase in risk from folks that eat venison, i will post all this below for your files Sir. i remember back in the BSE nvCJD days, from when the first BSE case in bovine was confirmed around 1984 maybe 83, i forget the good vets named that screwed it up first, Carol something, but from 83ish to 95 96 when nvCJD was linked to humans from BSE in cattle, so that took 10 to 15 years. hell, at that rate, especially with Texas and cwd zoonsis, hell, i'll be dead before it's official, if ever, so here ya go Sir. there was a grant study on cwd zoonosis that had been going on for some time, i followed it over the years, then the grant date for said study had expired, so, i thought i would write the good Professor about said study i.e. Professor Kong, CWRU et al. i will post the grant study abstract first, and then after that, what reply i got back, about said study that i was told not to post/publish...
CWD ZOONOSIS GRANT FIRST;
===============
Cervid to human prion transmission
Kong, Qingzhong
Case Western Reserve University, Cleveland, OH, United States
Abstract Prion disease is transmissible and invariably fatal. Chronic wasting disease (CWD) is the prion disease affecting deer, elk and moose, and it is a widespread and expanding epidemic affecting 22 US States and 2 Canadian provinces so far. CWD poses the most serious zoonotic prion transmission risks in North America because of huge venison consumption (>6 million deer/elk hunted and consumed annually in the USA alone), significant prion infectivity in muscles and other tissues/fluids from CWD-affected cervids, and usually high levels of individual exposure to CWD resulting from consumption of the affected animal among often just family and friends. However, we still do not know whether CWD prions can infect humans in the brain or peripheral tissues or whether clinical/asymptomatic CWD zoonosis has already occurred, and we have no essays to reliably detect CWD infection in humans. We hypothesize that: (1) The classic CWD prion strain can infect humans at low levels in the brain and peripheral lymphoid tissues; (2) The cervid-to-human transmission barrier is dependent on the cervid prion strain and influenced by the host (human) prion protein (PrP) primary sequence; (3) Reliable essays can be established to detect CWD infection in humans; and (4) CWD transmission to humans has already occurred. We will test these hypotheses in 4 Aims using transgenic (Tg) mouse models and complementary in vitro approaches.
Aim 1 will prove that the classical CWD strain may infect humans in brain or peripheral lymphoid tissues at low levels by conducting systemic bioassays in a set of humanized Tg mouse lines expressing common human PrP variants using a number of CWD isolates at varying doses and routes. Experimental human CWD samples will also be generated for Aim 3.
Aim 2 will test the hypothesis that the cervid-to-human prion transmission barrier is dependent on prion strain and influenced by the host (human) PrP sequence by examining and comparing the transmission efficiency and phenotypes of several atypical/unusual CWD isolates/strains as well as a few prion strains from other species that have adapted to cervid PrP sequence, utilizing the same panel of humanized Tg mouse lines as in Aim 1.
Aim 3 will establish reliable essays for detection and surveillance of CWD infection in humans by examining in details the clinical, pathological, biochemical and in vitro seeding properties of existing and future experimental human CWD samples generated from Aims 1-2 and compare them with those of common sporadic human Creutzfeldt-Jakob disease (sCJD) prions.
Aim 4 will attempt to detect clinical CWD-affected human cases by examining a significant number of brain samples from prion-affected human subjects in the USA and Canada who have consumed venison from CWD-endemic areas utilizing the criteria and essays established in Aim 3. The findings from this proposal will greatly advance our understandings on the potential and characteristics of cervid prion transmission in humans, establish reliable essays for CWD zoonosis and potentially discover the first case(s) of CWD infection in humans.
Public Health Relevance There are significant and increasing human exposure to cervid prions because chronic wasting disease (CWD, a widespread and highly infectious prion disease among deer and elk in North America) continues spreading and consumption of venison remains popular, but our understanding on cervid-to-human prion transmission is still very limited, raising public health concerns. This proposal aims to define the zoonotic risks of cervid prions and set up and apply essays to detect CWD zoonosis using mouse models and in vitro methods. The findings will greatly expand our knowledge on the potentials and characteristics of cervid prion transmission in humans, establish reliable essays for such infections and may discover the first case(s) of CWD infection in humans.
Funding Agency Agency National Institute of Health (NIH) Institute National Institute of Neurological Disorders and Stroke (NINDS) Type Research Project (R01) Project # 1R01NS088604-01A1 Application # 9037884 Study Section Cellular and Molecular Biology of Neurodegeneration Study Section (CMND) Program Officer Wong, May Project Start 2015-09-30 Project End 2019-07-31 Budget Start 2015-09-30 Budget End 2016-07-31 Support Year 1 Fiscal Year 2015 Total Cost $337,507 Indirect Cost $118,756
snip...
Professor Kongs reply to me just this month about above grant study that has NOT been published in peer reveiw yet...
=================================
Here is a brief summary of our findings:
snip...can't post, made a promise...tss
On Sat, Apr 3, 2021 at 12:19 PM Terry Singeltary <flounder9@verizon.net> wrote:
snip...
end...tss
==============
CWD ZOONOSIS THE FULL MONTY TO DATE
International Conference on Emerging Diseases, Outbreaks & Case Studies & 16th Annual Meeting on Influenza March 28-29, 2018 | Orlando, USA
Qingzhong Kong
Case Western Reserve University School of Medicine, USA
Zoonotic potential of chronic wasting disease prions from cervids
Chronic wasting disease (CWD) is the prion disease in cervids (mule deer, white-tailed deer, American elk, moose, and reindeer). It has become an epidemic in North America, and it has been detected in the Europe (Norway) since 2016. The widespread CWD and popular hunting and consumption of cervid meat and other products raise serious public health concerns, but questions remain on human susceptibility to CWD prions, especially on the potential difference in zoonotic potential among the various CWD prion strains. We have been working to address this critical question for well over a decade. We used CWD samples from various cervid species to inoculate transgenic mice expressing human or elk prion protein (PrP). We found infectious prions in the spleen or brain in a small fraction of CWD-inoculated transgenic mice expressing human PrP, indicating that humans are not completely resistant to CWD prions; this finding has significant ramifications on the public health impact of CWD prions. The influence of cervid PrP polymorphisms, the prion strain dependence of CWD-to-human transmission barrier, and the characterization of experimental human CWD prions will be discussed.
Speaker Biography Qingzhong Kong has completed his PhD from the University of Massachusetts at Amherst and Post-doctoral studies at Yale University. He is currently an Associate Professor of Pathology, Neurology and Regenerative Medicine. He has published over 50 original research papers in reputable journals (including Science Translational Medicine, JCI, PNAS and Cell Reports) and has been serving as an Editorial Board Member on seven scientific journals. He has multiple research interests, including public health risks of animal prions (CWD of cervids and atypical BSE of cattle), animal modeling of human prion diseases, mechanisms of prion replication and pathogenesis, etiology of sporadic Creutzfeldt-Jacob disease (CJD) in humans, normal cellular PrP in the biology and pathology of multiple brain and peripheral diseases, proteins responsible for the α-cleavage of cellular PrP, as well as gene therapy and DNA vaccination.
SUNDAY, JULY 25, 2021
North American and Norwegian Chronic Wasting Disease prions exhibit different potential for interspecies transmission and zoonotic risk
''Our data suggest that reindeer and red deer from Norway could be the most transmissible CWD prions to other mammals, whereas North American CWD prions were more prone to generate human prions in vitro.''
MONDAY, JULY 19, 2021
***> U Calgary researchers at work on a vaccine against a fatal infectious disease affecting deer and potentially people
Prion Conference 2018 Abstracts
BSE aka MAD COW DISEASE, was first discovered in 1984, and it took until 1995 to finally admit that BSE was causing nvCJD, the rest there is history, but that science is still evolving i.e. science now shows that indeed atypical L-type BSE, atypical Nor-98 Scrapie, and typical Scrapie are all zoonosis, zoonotic for humans, there from.
HOW long are we going to wait for Chronic Wasting Disease, CWD TSE Prion of Cervid, and zoonosis, zoonotic tranmission to humans there from?
Studies have shown since 1994 that humans are susceptible to CWD TSE Prion, so, what's the hold up with making CWD a zoonotic zoonosis disease, the iatrogenic transmissions there from is not waiting for someone to make a decision.
Prion Conference 2018 Abstracts
P190 Human prion disease mortality rates by occurrence of chronic wasting disease in freeranging cervids, United States
Abrams JY (1), Maddox RA (1), Schonberger LB (1), Person MK (1), Appleby BS (2), Belay ED (1)
(1) Centers for Disease Control and Prevention (CDC), National Center for Emerging and Zoonotic Infectious Diseases, Atlanta, GA, USA (2) Case Western Reserve University, National Prion Disease Pathology Surveillance Center (NPDPSC), Cleveland, OH, USA.
Background
Chronic wasting disease (CWD) is a prion disease of deer and elk that has been identified in freeranging cervids in 23 US states. While there is currently no epidemiological evidence for zoonotic transmission through the consumption of contaminated venison, studies suggest the CWD agent can cross the species barrier in experimental models designed to closely mimic humans. We compared rates of human prion disease in states with and without CWD to examine the possibility of undetermined zoonotic transmission.
Methods
Death records from the National Center for Health Statistics, case records from the National Prion Disease Pathology Surveillance Center, and additional state case reports were combined to create a database of human prion disease cases from 2003-2015. Identification of CWD in each state was determined through reports of positive CWD tests by state wildlife agencies. Age- and race-adjusted mortality rates for human prion disease, excluding cases with known etiology, were determined for four categories of states based on CWD occurrence: highly endemic (>16 counties with CWD identified in free-ranging cervids); moderately endemic (3-10 counties with CWD); low endemic (1-2 counties with CWD); and no CWD states. States were counted as having no CWD until the year CWD was first identified. Analyses stratified by age, sex, and time period were also conducted to focus on subgroups for which zoonotic transmission would be more likely to be detected: cases <55 years old, male sex, and the latter half of the study (2010-2015).
Results
Highly endemic states had a higher rate of prion disease mortality compared to non-CWD states (rate ratio [RR]: 1.12, 95% confidence interval [CI] = 1.01 - 1.23), as did low endemic states (RR: 1.15, 95% CI = 1.04 - 1.27). Moderately endemic states did not have an elevated mortality rate (RR: 1.05, 95% CI = 0.93 - 1.17). In age-stratified analyses, prion disease mortality rates among the <55 year old population were elevated for moderately endemic states (RR: 1.57, 95% CI = 1.10 – 2.24) while mortality rates were elevated among those ≥55 for highly endemic states (RR: 1.13, 95% CI = 1.02 - 1.26) and low endemic states (RR: 1.16, 95% CI = 1.04 - 1.29). In other stratified analyses, prion disease mortality rates for males were only elevated for low endemic states (RR: 1.27, 95% CI = 1.10 - 1.48), and none of the categories of CWD-endemic states had elevated mortality rates for the latter time period (2010-2015).
Conclusions
While higher prion disease mortality rates in certain categories of states with CWD in free-ranging cervids were noted, additional stratified analyses did not reveal markedly elevated rates for potentially sensitive subgroups that would be suggestive of zoonotic transmission. Unknown confounding factors or other biases may explain state-by-state differences in prion disease mortality.
=====
P172 Peripheral Neuropathy in Patients with Prion Disease
Wang H(1), Cohen M(1), Appleby BS(1,2)
(1) University Hospitals Cleveland Medical Center, Cleveland, Ohio (2) National Prion Disease Pathology Surveillance Center, Cleveland, Ohio.
Prion disease is a fatal progressive neurodegenerative disease due to deposition of an abnormal protease-resistant isoform of prion protein. Typical symptoms include rapidly progressive dementia, myoclonus, visual disturbance and hallucinations. Interestingly, in patients with prion disease, the abnormal protein canould also be found in the peripheral nervous system. Case reports of prion deposition in peripheral nerves have been reported. Peripheral nerve involvement is thought to be uncommon; however, little is known about the exact prevalence and features of peripheral neuropathy in patients with prion disease.
We reviewed autopsy-proven prion cases from the National Prion Disease Pathology Surveillance Center that were diagnosed between September 2016 to March 2017. We collected information regarding prion protein diagnosis, demographics, comorbidities, clinical symptoms, physical exam, neuropathology, molecular subtype, genetics lab, brain MRI, image and EMG reports. Our study included 104 patients. Thirteen (12.5%) patients had either subjective symptoms or objective signs of peripheral neuropathy. Among these 13 patients, 3 had other known potential etiologies of peripheral neuropathy such as vitamin B12 deficiency or prior chemotherapy. Among 10 patients that had no other clear etiology, 3 (30%) had familial CJD. The most common sCJD subtype was MV1-2 (30%), followed by MM1-2 (20%). The Majority of cases wasere male (60%). Half of them had exposure to wild game. The most common subjective symptoms were tingling and/or numbness of distal extremities. The most common objective finding was diminished vibratory sensation in the feet. Half of them had an EMG with the findings ranging from fasciculations to axonal polyneuropathy or demyelinating polyneuropathy.
Our study provides an overview of the pattern of peripheral neuropathy in patients with prion disease. Among patients with peripheral neuropathy symptoms or signs, majority has polyneuropathy. It is important to document the baseline frequency of peripheral neuropathy in prion diseases as these symptoms may become important when conducting surveillance for potential novel zoonotic prion diseases.
=====
P177 PrP plaques in methionine homozygous Creutzfeldt-Jakob disease patients as a potential marker of iatrogenic transmission
Abrams JY (1), Schonberger LB (1), Cali I (2), Cohen Y (2), Blevins JE (2), Maddox RA (1), Belay ED (1), Appleby BS (2), Cohen ML (2)
(1) Centers for Disease Control and Prevention (CDC), National Center for Emerging and Zoonotic Infectious Diseases, Atlanta, GA, USA (2) Case Western Reserve University, National Prion Disease Pathology Surveillance Center (NPDPSC), Cleveland, OH, USA.
Background
Sporadic Creutzfeldt-Jakob disease (CJD) is widely believed to originate from de novo spontaneous conversion of normal prion protein (PrP) to its pathogenic form, but concern remains that some reported sporadic CJD cases may actually be caused by disease transmission via iatrogenic processes. For cases with methionine homozygosity (CJD-MM) at codon 129 of the PRNP gene, recent research has pointed to plaque-like PrP deposition as a potential marker of iatrogenic transmission for a subset of cases. This phenotype is theorized to originate from specific iatrogenic source CJD types that comprise roughly a quarter of known CJD cases.
Methods
We reviewed scientific literature for studies which described PrP plaques among CJD patients with known epidemiological links to iatrogenic transmission (receipt of cadaveric human grown hormone or dura mater), as well as in cases of reported sporadic CJD. The presence and description of plaques, along with CJD classification type and other contextual factors, were used to summarize the current evidence regarding plaques as a potential marker of iatrogenic transmission. In addition, 523 cases of reported sporadic CJD cases in the US from January 2013 through September 2017 were assessed for presence of PrP plaques.
Results
We identified four studies describing 52 total cases of CJD-MM among either dura mater recipients or growth hormone recipients, of which 30 were identified as having PrP plaques. While sporadic cases were not generally described as having plaques, we did identify case reports which described plaques among sporadic MM2 cases as well as case reports of plaques exclusively in white matter among sporadic MM1 cases. Among the 523 reported sporadic CJD cases, 0 of 366 MM1 cases had plaques, 2 of 48 MM2 cases had kuru plaques, and 4 of 109 MM1+2 cases had either kuru plaques or both kuru and florid plaques. Medical chart review of the six reported sporadic CJD cases with plaques did not reveal clinical histories suggestive of potential iatrogenic transmission.
Conclusions
PrP plaques occur much more frequently for iatrogenic CJD-MM cases compared to sporadic CJDMM cases. Plaques may indicate iatrogenic transmission for CJD-MM cases without a type 2 Western blot fragment. The study results suggest the absence of significant misclassifications of iatrogenic CJD as sporadic. To our knowledge, this study is the first to describe grey matter kuru plaques in apparently sporadic CJD-MM patients with a type 2 Western blot fragment.
=====
P180 Clinico-pathological analysis of human prion diseases in a brain bank series
Ximelis T (1), Aldecoa I (1,2), Molina-Porcel L (1,3), Grau-Rivera O (4), Ferrer I (5), Nos C (6), Gelpi E (1,7), Sánchez-Valle R (1,4)
(1) Neurological Tissue Bank of the Biobanc-Hospital ClÃnic-IDIBAPS, Barcelona, Spain (2) Pathological Service of Hospital ClÃnic de Barcelona, Barcelona, Spain (3) EAIA Trastorns Cognitius, Centre Emili Mira, Parc de Salut Mar, Barcelona, Spain (4) Department of Neurology of Hospital ClÃnic de Barcelona, Barcelona, Spain (5) Institute of Neuropathology, Hospital Universitari de Bellvitge, Hospitalet de Llobregat, Barcelona (6) General subdirectorate of Surveillance and Response to Emergencies in Public Health, Department of Public Health in Catalonia, Barcelona, Spain (7) Institute of Neurology, Medical University of Vienna, Vienna, Austria.
Background and objective:
The Neurological Tissue Bank (NTB) of the Hospital Clínic-Institut d‘Investigacions Biomèdiques August Pi i Sunyer, Barcelona, Spain is the reference center in Catalonia for the neuropathological study of prion diseases in the region since 2001. The aim of this study is to analyse the characteristics of the confirmed prion diseases registered at the NTB during the last 15 years.
Methods:
We reviewed retrospectively all neuropathologically confirmed cases registered during the period January 2001 to December 2016.
Results:
176 cases (54,3% female, mean age: 67,5 years and age range: 25-86 years) of neuropathological confirmed prion diseases have been studied at the NTB. 152 cases corresponded to sporadic Creutzfeldt-Jakob disease (sCJD), 10 to genetic CJD, 10 to Fatal Familial Insomnia, 2 to GerstmannSträussler-Scheinker disease, and 2 cases to variably protease-sensitive prionopathy (VPSPr). Within sCJD subtypes the MM1 subtype was the most frequent, followed by the VV2 histotype.
Clinical and neuropathological diagnoses agreed in 166 cases (94%). The clinical diagnosis was not accurate in 10 patients with definite prion disease: 1 had a clinical diagnosis of Fronto-temporal dementia (FTD), 1 Niemann-Pick‘s disease, 1 Lewy Body‘s Disease, 2 Alzheimer‘s disease, 1 Cortico-basal syndrome and 2 undetermined dementia. Among patients with VPSPr, 1 had a clinical diagnosis of Amyotrophic lateral sclerosis (ALS) and the other one with FTD.
Concomitant pathologies are frequent in older age groups, mainly AD neuropathological changes were observed in these subjects.
Discussion:
A wide spectrum of human prion diseases have been identified in the NTB being the relative frequencies and main characteristics like other published series. There is a high rate of agreement between clinical and neuropathological diagnoses with prion diseases. These findings show the importance that public health has given to prion diseases during the past 15 years. Continuous surveillance of human prion disease allows identification of new emerging phenotypes. Brain tissue samples from these donors are available to the scientific community. For more information please visit:
=====
P192 Prion amplification techniques for the rapid evaluation of surface decontamination procedures
Bruyere-Ostells L (1), Mayran C (1), Belondrade M (1), Boublik Y (2), Haïk S (3), Fournier-Wirth C (1), Nicot S (1), Bougard D (1)
(1) Pathogenesis and control of chronic infections, Etablissement Français du Sang, Inserm, Université de Montpellier, Montpellier, France. (2) Centre de Recherche en Biologie cellulaire de Montpellier, CNRS, Université de Montpellier, Montpellier, France. (3) Inserm U 1127, CNRS UMR 7225, Sorbonne Universités, UPMC Université Paris 06 UMR S 1127, Institut du Cerveau et de la Moelle épinière, ICM, Paris, France.
Aims:
Transmissible Spongiform Encephalopathies (TSE) or prion diseases are a group of incurable and always fatal neurodegenerative disorders including Creutzfeldt-Jakob diseases (CJD) in humans. These pathologies include sporadic (sCJD), genetic and acquired (variant CJD) forms. By the past, sCJD and vCJD were transmitted by different prion contaminated biological materials to patients resulting in more than 400 iatrogenic cases (iCJD). The atypical nature and the biochemical properties of the infectious agent, formed by abnormal prion protein or PrPTSE, make it particularly resistant to conventional decontamination procedures. In addition, PrPTSE is widely distributed throughout the organism before clinical onset in vCJD and can also be detected in some peripheral tissues in sporadic CJD. Risk of iatrogenic transmission of CJD by contaminated medical device remains thus a concern for healthcare facilities. Bioassay is the gold standard method to evaluate the efficacy of prion decontamination procedures but is time-consuming and expensive. Here, we propose to compare in vitro prion amplification techniques: Protein Misfolding Cyclic Amplification (PMCA) and Real-Time Quaking Induced Conversion (RT-QuIC) for the detection of residual prions on surface after decontamination.
Methods:
Stainless steel wires, by mimicking the surface of surgical instruments, were proposed as a carrier model of prions for inactivation studies. To determine the sensitivity of the two amplification techniques on wires (Surf-PMCA and Surf-QuIC), steel wires were therefore contaminated with serial dilutions of brain homogenates (BH) from a 263k infected hamster and from a patient with sCJD (MM1 subtype). We then compared the different standard decontamination procedures including partially and fully efficient treatments by detecting the residual seeding activity on 263K and sCJD contaminated wires. We completed our study by the evaluation of marketed reagents endorsed for prion decontamination.
Results:
The two amplification techniques can detect minute quantities of PrPTSE adsorbed onto a single wire. 8/8 wires contaminated with a 10-6 dilution of 263k BH and 1/6 with the 10-8 dilution are positive with Surf-PMCA. Similar performances were obtained with Surf-QuIC on 263K: 10/16 wires contaminated with 10-6 dilution and 1/8 wires contaminated with 10-8 dilution are positive. Regarding the human sCJD-MM1 prion, Surf-QuIC allows us to detect 16/16 wires contaminated with 10-6 dilutions and 14/16 with 10-7 . Results obtained after decontamination treatments are very similar between 263K and sCJD prions. Efficiency of marketed treatments to remove prions is lower than expected.
Conclusions:
Surf-PMCA and Surf-QuIC are very sensitive methods for the detection of prions on wires and could be applied to prion decontamination studies for rapid evaluation of new treatments. Sodium hypochlorite is the only product to efficiently remove seeding activity of both 263K and sCJD prions.
=====
WA2 Oral transmission of CWD into Cynomolgus macaques: signs of atypical disease, prion conversion and infectivity in macaques and bio-assayed transgenic mice
Schatzl HM (1, 2), Hannaoui S (1, 2), Cheng Y-C (1, 2), Gilch S (1, 2), Beekes M (3), SchulzSchaeffer W (4), Stahl-Hennig C (5) and Czub S (2, 6)
(1) University of Calgary, Calgary Prion Research Unit, Calgary, Canada (2) University of Calgary, Faculty of Veterinary Medicine, Calgary, Canada, (3) Robert Koch Institute, Berlin, Germany, (4) University of Homburg/Saar, Homburg, Germany, (5) German Primate Center, Goettingen, Germany, (6) Canadian Food Inspection Agency (CFIA), Lethbridge, Canada.
To date, BSE is the only example of interspecies transmission of an animal prion disease into humans. The potential zoonotic transmission of CWD is an alarming issue and was addressed by many groups using a variety of in vitro and in vivo experimental systems. Evidence from these studies indicated a substantial, if not absolute, species barrier, aligning with the absence of epidemiological evidence suggesting transmission into humans. Studies in non-human primates were not conclusive so far, with oral transmission into new-world monkeys and no transmission into old-world monkeys. Our consortium has challenged 18 Cynomolgus macaques with characterized CWD material, focusing on oral transmission with muscle tissue. Some macaques have orally received a total of 5 kg of muscle material over a period of 2 years. After 5-7 years of incubation time some animals showed clinical symptoms indicative of prion disease, and prion neuropathology and PrPSc deposition were found in spinal cord and brain of euthanized animals. PrPSc in immunoblot was weakly detected in some spinal cord materials and various tissues tested positive in RT-QuIC, including lymph node and spleen homogenates. To prove prion infectivity in the macaque tissues, we have intracerebrally inoculated 2 lines of transgenic mice, expressing either elk or human PrP. At least 3 TgElk mice, receiving tissues from 2 different macaques, showed clinical signs of a progressive prion disease and brains were positive in immunoblot and RT-QuIC. Tissues (brain, spinal cord and spleen) from these and preclinical mice are currently tested using various read-outs and by second passage in mice. Transgenic mice expressing human PrP were so far negative for clear clinical prion disease (some mice >300 days p.i.). In parallel, the same macaque materials are inoculated into bank voles. Taken together, there is strong evidence of transmissibility of CWD orally into macaques and from macaque tissues into transgenic mouse models, although with an incomplete attack rate. The clinical and pathological presentation in macaques was mostly atypical, with a strong emphasis on spinal cord pathology. Our ongoing studies will show whether the transmission of CWD into macaques and passage in transgenic mice represents a form of non-adaptive prion amplification, and whether macaque-adapted prions have the potential to infect mice expressing human PrP. The notion that CWD can be transmitted orally into both new-world and old-world non-human primates asks for a careful reevaluation of the zoonotic risk of CWD.
See also poster P103
***> The notion that CWD can be transmitted orally into both new-world and old-world non-human primates asks for a careful reevaluation of the zoonotic risk of CWD.
=====
WA16 Monitoring Potential CWD Transmission to Humans
Belay ED
Centers for Disease Control and Prevention (CDC), National Center for Emerging and Zoonotic Infectious Diseases, Atlanta, GA, USA.
The spread of chronic wasting disease (CWD) in animals has raised concerns about increasing human exposure to the CWD agent via hunting and venison consumption, potentially facilitating CWD transmission to humans. Several studies have explored this possibility, including limited epidemiologic studies, in vitro experiments, and laboratory studies using various types of animal models. Most human exposures to the CWD agent in the United States would be expected to occur in association with deer and elk hunting in CWD-endemic areas. The Centers for Disease Control and Prevention (CDC) collaborated with state health departments in Colorado, Wisconsin, and Wyoming to identify persons at risk of CWD exposure and to monitor their vital status over time. Databases were established of persons who hunted in Colorado and Wyoming and those who reported consumption of venison from deer that later tested positive in Wisconsin. Information from the databases is periodically cross-checked with mortality data to determine the vital status and causes of death for deceased persons. Long-term follow-up of these hunters is needed to assess their risk of development of a prion disease linked to CWD exposure.
=====
P166 Characterization of CJD strain profiles in venison consumers and non-consumers from Alberta and Saskatchewan
Stephanie Booth (1,2), Lise Lamoureux (1), Debra Sorensen (1), Jennifer L. Myskiw (1,2), Megan Klassen (1,2), Michael Coulthart (3), Valerie Sim (4)
(1) Zoonotic Diseases and Special Pathogens, National Microbiology Laboratory, Public Health Agency of Canada, Winnipeg (2) Department of Medical Microbiology and Infectious Diseases, University of Manitoba, Winnipeg (3) Canadian CJD Surveillance System, Public Health Agency of Canada, Ottawa (4) Division of Neurology, Department of Medicine Centre for Prions and Protein Folding Diseases, University of Alberta, Edmonton.
Chronic wasting disease (CWD) is spreading rapidly through wild cervid populations in the Canadian provinces of Alberta and Saskatchewan. While this has implications for tourism and hunting, there is also concern over possible zoonotic transmission to humans who eat venison from infected deer. Whilst there is no evidence of any human cases of CWD to date, the Canadian CJD Surveillance System (CJDSS) in Canada is staying vigilant. When variant CJD occurred following exposure to BSE, the unique biochemical fingerprint of the pathologic PrP enabled a causal link to be confirmed. However, we cannot be sure what phenotype human CWD prions would present with, or indeed, whether this would be distinct from that see in sporadic CJD. Therefore we are undertaking a systematic analysis of the molecular diversity of CJD cases of individuals who resided in Alberta and Saskatchewan at their time of death comparing venison consumers and non-consumers, using a variety of clinical, imaging, pathological and biochemical markers. Our initial objective is to develop novel biochemical methodologies that will extend the baseline glycoform and genetic polymorphism typing that is already completed by the CJDSS. Firstly, we are reviewing MRI, EEG and pathology information from over 40 cases of CJD to select clinically affected areas for further investigation. Biochemical analysis will include assessment of the levels of protease sensitive and resistant prion protein, glycoform typing using 2D gel electrophoresis, testing seeding capabilities and kinetics of aggregation by quaking-induced conversion, and determining prion oligomer size distributions with asymmetric flow field fractionation with in-line light scattering. Progress and preliminary data will be presented. Ultimately, we intend to further define the relationship between PrP structure and disease phenotype and establish a baseline for the identification of future atypical CJD cases that may arise as a result of exposure to CWD.
=====
Source Prion Conference 2018 Abstracts
Volume 24, Number 8—August 2018 Research Susceptibility of Human Prion Protein to Conversion by Chronic Wasting Disease Prions
Marcelo A. BarriaComments to Author , Adriana Libori, Gordon Mitchell, and Mark W. Head Author affiliations: National CJD Research and Surveillance Unit, University of Edinburgh, Edinburgh, Scotland, UK (M.A. Barria, A. Libori, M.W. Head); National and OIE Reference Laboratory for Scrapie and CWD, Canadian Food Inspection Agency, Ottawa, Ontario, Canada (G. Mitchell)
Abstract Chronic wasting disease (CWD) is a contagious and fatal neurodegenerative disease and a serious animal health issue for deer and elk in North America. The identification of the first cases of CWD among free-ranging reindeer and moose in Europe brings back into focus the unresolved issue of whether CWD can be zoonotic like bovine spongiform encephalopathy. We used a cell-free seeded protein misfolding assay to determine whether CWD prions from elk, white-tailed deer, and reindeer in North America can convert the human prion protein to the disease-associated form. We found that prions can convert, but the efficiency of conversion is affected by polymorphic variation in the cervid and human prion protein genes. In view of the similarity of reindeer, elk, and white-tailed deer in North America to reindeer, red deer, and roe deer, respectively, in Europe, a more comprehensive and thorough assessment of the zoonotic potential of CWD might be warranted.
snip...
Discussion Characterization of the transmission properties of CWD and evaluation of their zoonotic potential are important for public health purposes. Given that CWD affects several members of the family Cervidae, it seems reasonable to consider whether the zoonotic potential of CWD prions could be affected by factors such as CWD strain, cervid species, geographic location, and Prnp–PRNP polymorphic variation. We have previously used an in vitro conversion assay (PMCA) to investigate the susceptibility of the human PrP to conversion to its disease-associated form by several animal prion diseases, including CWD (15,16,22). The sensitivity of our molecular model for the detection of zoonotic conversion depends on the combination of 1) the action of proteinase K to degrade the abundant human PrPC that constitutes the substrate while only N terminally truncating any human PrPres produced and 2) the presence of the 3F4 epitope on human but not cervid PrP. In effect, this degree of sensitivity means that any human PrPres formed during the PMCA reaction can be detected down to the limit of Western blot sensitivity. In contrast, if other antibodies that detect both cervid and human PrP are used, such as 6H4, then newly formed human PrPres must be detected as a measurable increase in PrPres over the amount remaining in the reaction product from the cervid seed. Although best known for the efficient amplification of prions in research and diagnostic contexts, the variation of the PMCA method employed in our study is optimized for the definitive detection of zoonotic reaction products of inherently inefficient conversion reactions conducted across species barriers. By using this system, we previously made and reported the novel observation that elk CWD prions could convert human PrPC from human brain and could also convert recombinant human PrPC expressed in transgenic mice and eukaryotic cell cultures (15).
A previous publication suggested that mule deer PrPSc was unable to convert humanized transgenic substrate in PMCA assays (23) and required a further step of in vitro conditioning in deer substrate PMCA before it was able to cross the deer–human molecular barrier (24). However, prions from other species, such as elk (15) and reindeer affected by CWD, appear to be compatible with the human protein in a single round of amplification (as shown in our study). These observations suggest that different deer species affected by CWD could present differing degrees of the olecular compatibility with the normal form of human PrP.
The contribution of the polymorphism at codon 129 of the human PrP gene has been extensively studied and is recognized as a risk factor for Creutzfeldt-Jakob disease (4). In cervids, the equivalent codon corresponds to the position 132 encoding methionine or leucine. This polymorphism in the elk gene has been shown to play an important role in CWD susceptibility (25,26). We have investigated the effect of this cervid Prnp polymorphism on the conversion of the humanized transgenic substrate according to the variation in the equivalent PRNP codon 129 polymorphism. Interestingly, only the homologs methionine homozygous seed–substrate reactions could readily convert the human PrP, whereas the heterozygous elk PrPSc was unable to do so, even though comparable amounts of PrPres were used to seed the reaction. In addition, we observed only low levels of human PrPres formation in the reactions seeded with the homozygous methionine (132 MM) and the heterozygous (132 ML) seeds incubated with the other 2 human polymorphic substrates (129 MV and 129 VV). The presence of the amino acid leucine at position 132 of the elk Prnp gene has been attributed to a lower degree of prion conversion compared with methionine on the basis of experiments in mice made transgenic for these polymorphic variants (26). Considering the differences observed for the amplification of the homozygous human methionine substrate by the 2 polymorphic elk seeds (MM and ML), reappraisal of the susceptibility of human PrPC by the full range of cervid polymorphic variants affected by CWD would be warranted.
In light of the recent identification of the first cases of CWD in Europe in a free-ranging reindeer (R. tarandus) in Norway (2), we also decided to evaluate the in vitro conversion potential of CWD in 2 experimentally infected reindeer (18). Formation of human PrPres was readily detectable after a single round of PMCA, and in all 3 humanized polymorphic substrates (MM, MV, and VV). This finding suggests that CWD prions from reindeer could be more compatible with human PrPC generally and might therefore present a greater risk for zoonosis than, for example, CWD prions from white-tailed deer. A more comprehensive comparison of CWD in the affected species, coupled with the polymorphic variations in the human and deer PRNP–Prnp genes, in vivo and in vitro, will be required before firm conclusions can be drawn. Analysis of the Prnp sequence of the CWD reindeer in Norway was reported to be identical to the specimens used in our study (2). This finding raises the possibility of a direct comparison of zoonotic potential between CWD acquired in the wild and that produced in a controlled laboratory setting. (Table).
The prion hypothesis proposes that direct molecular interaction between PrPSc and PrPC is necessary for conversion and prion replication. Accordingly, polymorphic variants of the PrP of host and agent might play a role in determining compatibility and potential zoonotic risk. In this study, we have examined the capacity of the human PrPC to support in vitro conversion by elk, white-tailed deer, and reindeer CWD PrPSc. Our data confirm that elk CWD prions can convert the human PrPC, at least in vitro, and show that the homologous PRNP polymorphisms at codon 129 and 132 in humans and cervids affect conversion efficiency. Other species affected by CWD, particularly caribou or reindeer, also seem able to convert the human PrP. It will be important to determine whether other polymorphic variants found in other CWD-affected Cervidae or perhaps other factors (17) exert similar effects on the ability to convert human PrP and thus affect their zoonotic potential.
Dr. Barria is a research scientist working at the National CJD Research and Surveillance Unit, University of Edinburgh. His research has focused on understanding the molecular basis of a group of fatal neurologic disorders called prion diseases.
Acknowledgments We thank Aru Balachandran for originally providing cervid brain tissues, Abigail Diack and Jean Manson for providing mouse brain tissue, and James Ironside for his critical reading of the manuscript at an early stage.
This report is independent research commissioned and funded by the United Kingdom’s Department of Health Policy Research Programme and the Government of Scotland. The views expressed in this publication are those of the authors and not necessarily those of the Department of Health or the Government of Scotland.
Author contributions: The study was conceived and designed by M.A.B. and M.W.H. The experiments were conducted by M.A.B. and A.L. Chronic wasting disease brain specimens were provided by G.M. The manuscript was written by M.A.B. and M.W.H. All authors contributed to the editing and revision of the manuscript.
Prion 2017 Conference Abstracts
First evidence of intracranial and peroral transmission of Chronic Wasting Disease (CWD) into Cynomolgus macaques: a work in progress Stefanie Czub1, Walter Schulz-Schaeffer2, Christiane Stahl-Hennig3, Michael Beekes4, Hermann Schaetzl5 and Dirk Motzkus6 1
University of Calgary Faculty of Veterinary Medicine/Canadian Food Inspection Agency; 2Universitatsklinikum des Saarlandes und Medizinische Fakultat der Universitat des Saarlandes; 3 Deutsches Primaten Zentrum/Goettingen; 4 Robert-Koch-Institut Berlin; 5 University of Calgary Faculty of Veterinary Medicine; 6 presently: Boehringer Ingelheim Veterinary Research Center; previously: Deutsches Primaten Zentrum/Goettingen
This is a progress report of a project which started in 2009.
21 cynomolgus macaques were challenged with characterized CWD material from white-tailed deer (WTD) or elk by intracerebral (ic), oral, and skin exposure routes. Additional blood transfusion experiments are supposed to assess the CWD contamination risk of human blood product. Challenge materials originated from symptomatic cervids for ic, skin scarification and partially per oral routes (WTD brain). Challenge material for feeding of muscle derived from preclinical WTD and from preclinical macaques for blood transfusion experiments. We have confirmed that the CWD challenge material contained at least two different CWD agents (brain material) as well as CWD prions in muscle-associated nerves.
Here we present first data on a group of animals either challenged ic with steel wires or per orally and sacrificed with incubation times ranging from 4.5 to 6.9 years at postmortem. Three animals displayed signs of mild clinical disease, including anxiety, apathy, ataxia and/or tremor. In four animals wasting was observed, two of those had confirmed diabetes. All animals have variable signs of prion neuropathology in spinal cords and brains and by supersensitive IHC, reaction was detected in spinal cord segments of all animals. Protein misfolding cyclic amplification (PMCA), real-time quaking-induced conversion (RT-QuiC) and PET-blot assays to further substantiate these findings are on the way, as well as bioassays in bank voles and transgenic mice.
At present, a total of 10 animals are sacrificed and read-outs are ongoing. Preclinical incubation of the remaining macaques covers a range from 6.4 to 7.10 years. Based on the species barrier and an incubation time of > 5 years for BSE in macaques and about 10 years for scrapie in macaques, we expected an onset of clinical disease beyond 6 years post inoculation.
PRION 2017 DECIPHERING NEURODEGENERATIVE DISORDERS ABSTRACTS REFERENCE
8. Even though human TSE‐exposure risk through consumption of game from European cervids can be assumed to be minor, if at all existing, no final conclusion can be drawn due to the overall lack of scientific data. In particular the US data do not clearly exclude the possibility of human (sporadic or familial) TSE development due to consumption of venison. The Working Group thus recognizes a potential risk to consumers if a TSE would be present in European cervids. It might be prudent considering appropriate measures to reduce such a risk, e.g. excluding tissues such as CNS and lymphoid tissues from the human food chain, which would greatly reduce any potential risk for consumers. However, it is stressed that currently, no data regarding a risk of TSE infections from cervid products are available.
SATURDAY, FEBRUARY 23, 2019
Chronic Wasting Disease CWD TSE Prion and THE FEAST 2003 CDC an updated review of the science 2019
TUESDAY, NOVEMBER 04, 2014
Six-year follow-up of a point-source exposure to CWD contaminated venison in an Upstate New York community: risk behaviours and health outcomes 2005–2011
Authors, though, acknowledged the study was limited in geography and sample size and so it couldn't draw a conclusion about the risk to humans. They recommended more study. Dr. Ermias Belay was the report's principal author but he said New York and Oneida County officials are following the proper course by not launching a study. "There's really nothing to monitor presently. No one's sick," Belay said, noting the disease's incubation period in deer and elk is measured in years. "
Transmission Studies
Mule deer transmissions of CWD were by intracerebral inoculation and compared with natural cases {the following was written but with a single line marked through it ''first passage (by this route)}....TSS
resulted in a more rapidly progressive clinical disease with repeated episodes of synocopy ending in coma. One control animal became affected, it is believed through contamination of inoculum (?saline). Further CWD transmissions were carried out by Dick Marsh into ferret, mink and squirrel monkey. Transmission occurred in ALL of these species with the shortest incubation period in the ferret.
snip....
Prion Infectivity in Fat of Deer with Chronic Wasting Disease▿
Brent Race#, Kimberly Meade-White#, Richard Race and Bruce Chesebro* + Author Affiliations
In mice, prion infectivity was recently detected in fat. Since ruminant fat is consumed by humans and fed to animals, we determined infectivity titers in fat from two CWD-infected deer. Deer fat devoid of muscle contained low levels of CWD infectivity and might be a risk factor for prion infection of other species.
Prions in Skeletal Muscles of Deer with Chronic Wasting Disease
Here bioassays in transgenic mice expressing cervid prion protein revealed the presence of infectious prions in skeletal muscles of CWD-infected deer, demonstrating that humans consuming or handling meat from CWD-infected deer are at risk to prion exposure.
*** now, let’s see what the authors said about this casual link, personal communications years ago, and then the latest on the zoonotic potential from CWD to humans from the TOKYO PRION 2016 CONFERENCE.
see where it is stated NO STRONG evidence. so, does this mean there IS casual evidence ???? “Our conclusion stating that we found no strong evidence of CWD transmission to humans”
From: TSS
Subject: CWD aka MAD DEER/ELK TO HUMANS ???
Date: September 30, 2002 at 7:06 am PST
From: "Belay, Ermias"
To: Cc: "Race, Richard (NIH)" ; ; "Belay, Ermias"
Sent: Monday, September 30, 2002 9:22 AM
Subject: RE: TO CDC AND NIH - PUB MED- 3 MORE DEATHS - CWD - YOUNG HUNTERS
Dear Sir/Madam,
In the Archives of Neurology you quoted (the abstract of which was attached to your email), we did not say CWD in humans will present like variant CJD.. That assumption would be wrong. I encourage you to read the whole article and call me if you have questions or need more clarification (phone: 404-639-3091). Also, we do not claim that "no-one has ever been infected with prion disease from eating venison." Our conclusion stating that we found no strong evidence of CWD transmission to humans in the article you quoted or in any other forum is limited to the patients we investigated.
Ermias Belay, M.D. Centers for Disease Control and Prevention
-----Original Message-----
From: Sent: Sunday, September 29, 2002 10:15 AM
Subject: TO CDC AND NIH - PUB MED- 3 MORE DEATHS - CWD - YOUNG HUNTERS
Sunday, November 10, 2002 6:26 PM .......snip........end..............TSS
Thursday, April 03, 2008
A prion disease of cervids: Chronic wasting disease 2008 1: Vet Res. 2008 Apr 3;39(4):41 A prion disease of cervids: Chronic wasting disease Sigurdson CJ.
snip...
*** twenty-seven CJD patients who regularly consumed venison were reported to the Surveillance Center***,
snip... full text ;
> However, to date, no CWD infections have been reported in people.
sporadic, spontaneous CJD, 85%+ of all human TSE, did not just happen. never in scientific literature has this been proven.
if one looks up the word sporadic or spontaneous at pubmed, you will get a laundry list of disease that are classified in such a way;
sporadic = 54,983 hits https://www.ncbi.nlm.nih.gov/pubmed/?term=sporadic
spontaneous = 325,650 hits https://www.ncbi.nlm.nih.gov/pubmed/?term=spontaneous
key word here is 'reported'. science has shown that CWD in humans will look like sporadic CJD. SO, how can one assume that CWD has not already transmitted to humans? they can't, and it's as simple as that. from all recorded science to date, CWD has already transmitted to humans, and it's being misdiagnosed as sporadic CJD. ...terry
*** LOOKING FOR CWD IN HUMANS AS nvCJD or as an ATYPICAL CJD, LOOKING IN ALL THE WRONG PLACES $$$ ***
> However, to date, no CWD infections have been reported in people.
key word here is ‘reported’. science has shown that CWD in humans will look like sporadic CJD. SO, how can one assume that CWD has not already transmitted to humans? they can’t, and it’s as simple as that. from all recorded science to date, CWD has already transmitted to humans, and it’s being misdiagnosed as sporadic CJD. …terry
*** LOOKING FOR CWD IN HUMANS AS nvCJD or as an ATYPICAL CJD, LOOKING IN ALL THE WRONG PLACES $$$ ***
*** These results would seem to suggest that CWD does indeed have zoonotic potential, at least as judged by the compatibility of CWD prions and their human PrPC target. Furthermore, extrapolation from this simple in vitro assay suggests that if zoonotic CWD occurred, it would most likely effect those of the PRNP codon 129-MM genotype and that the PrPres type would be similar to that found in the most common subtype of sCJD (MM1).***
CWD TSE PRION AND ZOONOTIC, ZOONOSIS, POTENTIAL
Subject: Re: DEER SPONGIFORM ENCEPHALOPATHY SURVEY & HOUND STUDY
Date: Fri, 18 Oct 2002 23:12:22 +0100
From: Steve Dealler
Reply-To: Bovine Spongiform Encephalopathy Organization: Netscape Online member
To: BSE-L@ References: <3daf5023 .4080804="" wt.net="">
Dear Terry,
An excellent piece of review as this literature is desparately difficult to get back from Government sites.
What happened with the deer was that an association between deer meat eating and sporadic CJD was found in about 1993. The evidence was not great but did not disappear after several years of asking CJD cases what they had eaten. I think that the work into deer disease largely stopped because it was not helpful to the UK industry...and no specific cases were reported. Well, if you dont look adequately like they are in USA currenly then you wont find any!
Steve Dealler ===============
''The association between venison eating and risk of CJD shows similar pattern, with regular venison eating associated with a 9 FOLD INCREASE IN RISK OF CJD (p = 0.04).''
CREUTZFELDT JAKOB DISEASE SURVEILLANCE IN THE UNITED KINGDOM THIRD ANNUAL REPORT AUGUST 1994
Consumption of venison and veal was much less widespread among both cases and controls. For both of these meats there was evidence of a trend with increasing frequency of consumption being associated with increasing risk of CJD. (not nvCJD, but sporadic CJD...tss) These associations were largely unchanged when attention was restricted to pairs with data obtained from relatives. ...
Table 9 presents the results of an analysis of these data.
There is STRONG evidence of an association between ‘’regular’’ veal eating and risk of CJD (p = .0.01).
Individuals reported to eat veal on average at least once a year appear to be at 13 TIMES THE RISK of individuals who have never eaten veal.
There is, however, a very wide confidence interval around this estimate. There is no strong evidence that eating veal less than once per year is associated with increased risk of CJD (p = 0.51).
The association between venison eating and risk of CJD shows similar pattern, with regular venison eating associated with a 9 FOLD INCREASE IN RISK OF CJD (p = 0.04).
There is some evidence that risk of CJD INCREASES WITH INCREASING FREQUENCY OF LAMB EATING (p = 0.02).
The evidence for such an association between beef eating and CJD is weaker (p = 0.14). When only controls for whom a relative was interviewed are included, this evidence becomes a little STRONGER (p = 0.08).
snip...
It was found that when veal was included in the model with another exposure, the association between veal and CJD remained statistically significant (p = < 0.05 for all exposures), while the other exposures ceased to be statistically significant (p = > 0.05).
snip...
In conclusion, an analysis of dietary histories revealed statistical associations between various meats/animal products and INCREASED RISK OF CJD. When some account was taken of possible confounding, the association between VEAL EATING AND RISK OF CJD EMERGED AS THE STRONGEST OF THESE ASSOCIATIONS STATISTICALLY. ...
snip...
In the study in the USA, a range of foodstuffs were associated with an increased risk of CJD, including liver consumption which was associated with an apparent SIX-FOLD INCREASE IN THE RISK OF CJD. By comparing the data from 3 studies in relation to this particular dietary factor, the risk of liver consumption became non-significant with an odds ratio of 1.2 (PERSONAL COMMUNICATION, PROFESSOR A. HOFMAN. ERASMUS UNIVERSITY, ROTTERDAM). (???...TSS)
snip...see full report ;
http://web.archive.org/web/20090506050043/http://www.bseinquiry.gov.uk/files/yb/1994/08/00004001.pdf
http://web.archive.org/web/20090506050244/http://www.bseinquiry.gov.uk/files/yb/1994/07/00001001.pdf
BSE Inquiry Steve Dealler
Management In Confidence
BSE: Private Submission of Bovine Brain Dealler
snip...see full text;
MONDAY, FEBRUARY 25, 2019
***> MAD DOGS AND ENGLISHMEN BSE, SCRAPIE, CWD, CJD, TSE PRION A REVIEW 2019
***> ''The association between venison eating and risk of CJD shows similar pattern, with regular venison eating associated with a 9 FOLD INCREASE IN RISK OF CJD (p = 0.04).''
***> In conclusion, sensory symptoms and loss of reflexes in Gerstmann-Sträussler-Scheinker syndrome can be explained by neuropathological changes in the spinal cord. We conclude that the sensory symptoms and loss of lower limb reflexes in Gerstmann-Sträussler-Scheinker syndrome is due to pathology in the caudal spinal cord. <***
***> The clinical and pathological presentation in macaques was mostly atypical, with a strong emphasis on spinal cord pathology.<***
***> The notion that CWD can be transmitted orally into both new-world and old-world non-human primates asks for a careful reevaluation of the zoonotic risk of CWD. <***
***> All animals have variable signs of prion neuropathology in spinal cords and brains and by supersensitive IHC, reaction was detected in spinal cord segments of all animals.<***
***> In particular the US data do not clearly exclude the possibility of human (sporadic or familial) TSE development due to consumption of venison. The Working Group thus recognizes a potential risk to consumers if a TSE would be present in European cervids.'' Scientific opinion on chronic wasting disease (II) <***
North American and Norwegian Chronic Wasting Disease prions exhibit different potential for interspecies transmission and zoonotic risk
Sandra Pritzkow1,*, Damian Gorski1,*, Frank Ramirez1 , Glenn C. Telling2 , Sylvie L. Benestad3 and Claudio Soto1,#
1 Mitchell Center for Alzheimer's disease and related Brain disorders, Department of Neurology, University of Texas McGovern Medical School at Houston, Texas, USA 2 Prion Research Center, Department of Microbiology, Immunology and Pathology, Colorado State University, Fort Collins, Colorado, USA 3 Norwegian Veterinary Institute, OIE Reference Laboratory for CWD, Oslo, Norway.
Summary: We investigated the in vitro spillover and zoonotic potential of CWD from various cervid species. Our results suggest that Norway CWD prions have a higher potential to infect other animals, but NorthAmerican CWD appear more prone to generate human prions.
The current evidence for CWD transmission to humans is controversial; indeed, while transgenic mice expressing human PrP did not develop disease when challenged with CWD prions in various laboratories [6-8, 41], experimental inoculation of CWD into squirrel monkeys produced disease [9, 10]. Studies in macaques, which are phylogenetically closer to humans than squirrel monkeys [45] have shown mixed results. A study from Czub and colleagues found that CWD prions can induce disease and pathologic abnormalities typical of prion disease in macaques exposed to CWD prions, even by oral inoculation of muscle tissue from cervids affected by CWD [46]. However, a different study found no evidence for prion disease in macaques inoculated with CWD [47]. To assess the cervid/human species barrier, we previously used PMCA to determine prion replication in vitro. We found that, after stabilization by successive passages in deer PrPC, PrPSc from CWD infected deer can convert human PrPC into a novel form of PrPSc [13]. Our current study to evaluate in vitro zoonotic potential of various CWD prions showed that although the cervid/human barrier is large, we were able to observe generation of human PrPSc with some specific CWD strains in a second round of PMCA (Fig. 5). The three North American CWD isolates were capable to sustain generation of human PrPSc, with white-tailed deer showing the highest efficiency. Conversely, none of the three Norway CWD isolates generated any detectable PrPSc signal up to the second round of PMCA. This data suggest that North American CWD prions might be of a greater risk to humans than the infected animals in Northern Europe. We speculate that these differences might be due to Norwegian CWD being less stable prion strains as compared to North American CWD, which have had longer time to replicate in cervids and become stabilized through many rounds of natural infection. Our findings may provide important information to understand the diversity of natural CWD prion strains in different animals across distinct geographical areas and their consequences for the spillover into other animal species, including humans.
MONDAY, JULY 19, 2021
U Calgary researchers at work on a vaccine against a fatal infectious disease affecting deer and potentially people
TUESDAY, JULY 13, 2021
Chronic Wasting Disease and the Canadian Agriculture and Agri-food Sectors Current Knowledge Risks and Policy Options
''The science is progressing on the possibility of transmission of CWD to humans through oral transmission, but the complete assessment of this possibility remains to be done.''
MONDAY, DECEMBER 16, 2019
Chronic Wasting Disease CWD TSE Prion aka mad cow type disease in cervid Zoonosis Update
***> ''In particular the US data do not clearly exclude the possibility of human (sporadic or familial) TSE development due to consumption of venison. The Working Group thus recognizes a potential risk to consumers if a TSE would be present in European cervids.'' Scientific opinion on chronic wasting disease (II) <***
What if?
CHRONIC WASTING DISEASE CWD TSE PRION
TRUCKING CWD TSE PRION
WEDNESDAY, SEPTEMBER 29, 2021
Wisconsin Vilas County Deer Farm Tests Positive for CWD
WEDNESDAY, SEPTEMBER 29, 2021
Minnesota DNR learns of 2 Minnesota deer farms that received deer from a CWD-positive farm in Wisconsin
SUNDAY, SEPTEMBER 26, 2021
Wisconsin Agriculture officials grappling with fate of CWD-positive deer farm in Taylor County
TEXAS CWD TSE PRION
FRIDAY, SEPTEMBER 17, 2021
Texas Chronic Wasting Disease management rules headed for change
More than 30 white-tailed deer have tested positive from these facilities, which sparked a massive epidemiological investigation that has encompassed 181 trace breeding facilities and 119 release sites.
TUESDAY, AUGUST 31, 2021
TEXAS CHRONIC WASTING DISEASE CWD TSE PRION HAS CONFIRMED 260 CASES TO DATE
CWD Zone | Species | Total |
Trans Pecos | Mule Deer - Free Range | 34 |
Panhandle | Mule Deer - Free Range | 17 |
Elk - Free Range | 1 | |
White-tailed Deer - Free Range | 5 | |
South-Central Texas | White-tailed Deer - Free Range | 8 |
White-tailed Deer - Breeder Pen | 149 | |
White-tailed Deer - Breeder Release Site | 20 | |
Elk - Breeder Release Site | 3 | |
Red Deer - Breeder Release Site | 2 | |
Del Rio | White-tailed Deer - Free Range | 3 |
Kimble County | White-tailed Deer - Breeder Pen | 10 |
Northeast Texas | White-tailed Deer - Breeder Pen | 5 |
Coastal Prairie | White-tailed Deer - Breeder Pen | 1 |
Central Texas | White-tailed Deer - Breeder Pen | 1 |
South Texas | White-tailed Deer - Breeder Pen | 1 |
Grand Total | 260 |
PERSONAL COMMUNICATION TPWD ET AL...terry
TUESDAY, AUGUST 31, 2021
TEXAS CHRONIC WASTING DISEASE CWD TSE PRION HAS CONFIRMED 260 CASES TO DATE
RE: TAHC Chapter 40, Chronic Wasting Disease Terry Singeltary Comment Submission
Mr. Singeltary,
This email is to acknowledge receipt of your proposed rule comments. Thank you for your interest and participation in the Texas Animal Health Commission’s rulemaking process.
Sincerely,
Amanda
Amanda Bernhard
Assistant to the Executive Director
Texas Animal Health Commission
512-719-0704
From: Terry Singeltary <flounder9@verizon.net>
Sent: Wednesday, August 11, 2021 12:26 PM
To: comments <comments@tahc.texas.gov>
Cc: General Counsel <gencounsel@tahc.texas.gov>
Subject: TAHC Chapter 40, Chronic Wasting Disease Terry Singeltary Comment Submission
Subject: TAHC Chapter 40, Chronic Wasting Disease Terry Singeltary Comment Submission
TAHC Chapter 40, Chronic Wasting Disease Terry Singeltary Comment Submission
WEDNESDAY, AUGUST 11, 2021
TAHC Chapter 40, Chronic Wasting Disease Terry Singeltary Comment Submission
-----Original Message-----
From: Terry Singeltary
To: comments
Sent: Fri, Dec 20, 2019 3:53 pm
Subject: Texas TAHC, Administrative Code, Title 4, Part 2, Chapter 40, Chronic Wasting Disease Amendments Open For Comment beginning December 20, 2019 thru January 20, 2020 Terry Singeltary Comments Submission
----Original Message-----
From: Terry Singeltary <flounder9@verizon.net>
Sent: Sat, Aug 8, 2020 4:39 pm
Subject: TAHC Chapter 40, Chronic Wasting Disease Singeltary Comment Submission August 8, 2020
TAHC Chapter 40, Chronic Wasting Disease Singeltary Comment Submission August 8, 2020
WEDNESDAY, SEPTEMBER 01, 2021
Michigan CWD TSE Prion 211 Cases To Date
TUESDAY, AUGUST 31, 2021
TENNESSEE CWD TSE PRION CONFIRMED TO DATE 1300 POSITIVES IN 3 YEARS
''TURNS OUT WE HAVE A LOT OF IT, OVER A PRETTY BROAD AREA''
MONDAY, AUGUST 30, 2021
MONTANA CWD TSE PRION UPDATE What's new for chronic wasting disease (CWD) management for 2021
WEDNESDAY, AUGUST 25, 2021
Arkansas CWD TSE Prion 1113 CONFIRMED TO DATE JUST TIP OF ICEBERG Public Meeting Mississippi, AR VIDEO
Genes (Basel) . 2021 Sep 10;12(9):1396. doi: 10.3390/genes12091396.
Selective Breeding for Disease-Resistant PRNP Variants to Manage Chronic Wasting Disease in Farmed Whitetail Deer
Nicholas Haley 1, Rozalyn Donner 1, Kahla Merrett 1, Matthew Miller 1, Kristen Senior 1
Affiliations expand
PMID: 34573378 DOI: 10.3390/genes12091396
Abstract
Chronic wasting disease (CWD) is a fatal transmissible spongiform encephalopathy (TSE) of cervids caused by a misfolded variant of the normal cellular prion protein, and it is closely related to sheep scrapie. Variations in a host's prion gene, PRNP, and its primary protein structure dramatically affect susceptibility to specific prion disorders, and breeding for PRNP variants that prevent scrapie infection has led to steep declines in the disease in North American and European sheep. While resistant alleles have been identified in cervids, a PRNP variant that completely prevents CWD has not yet been identified. Thus, control of the disease in farmed herds traditionally relies on quarantine and depopulation. In CWD-endemic areas, depopulation of private herds becomes challenging to justify, leading to opportunities to manage the disease in situ. We developed a selective breeding program for farmed white-tailed deer in a high-prevalence CWD-endemic area which focused on reducing frequencies of highly susceptible PRNP variants and introducing animals with less susceptible variants. With the use of newly developed primers, we found that breeding followed predictable Mendelian inheritance, and early data support our project's utility in reducing CWD prevalence. This project represents a novel approach to CWD management, with future efforts building on these findings.
Keywords: CWD; PRNP; deer; prion; resistance; selective breeding; susceptibility.
In Moore et al., reindeer carrying allele E had longer survival-times following intracranial exposure [24]. In the same experiment, a reindeer with a genotype carrier of E, found dead without showing clinical signs ~13 months post-intracranial inoculation, had no histopathological lesions or PrPSc deposition at post-mortem examination.
snip...
Our data support the notion that PRNP genetic variation modulates CWD susceptibility rather than conferring complete resistance. This is in agreement with experimental observations of reindeer-developing CWD after intracranial inoculation regardless of PRNP genotype [24].
Published: 27 May 2021
White-tailed deer S96 prion protein does not support stable in vitro propagation of most common CWD strains
Alicia Otero, Camilo Duque Velásquez, Judd Aiken & Debbie McKenzie
Scientific Reports volume 11, Article number: 11193 (2021) Cite this article
923 Accesses
12 Altmetric
Metrics details
Abstract
PrPC variation at residue 96 (G/S) plays an important role in the epidemiology of chronic wasting disease (CWD) in exposed white-tailed deer populations. In vivo studies have demonstrated the protective effect of serine at codon 96, which hinders the propagation of common CWD strains when expressed in homozygosis and increases the survival period of S96/wt heterozygous deer after challenge with CWD. Previous in vitro studies of the transmission barrier suggested that following a single amplification step, wt and S96 PrPC were equally susceptible to misfolding when seeded with various CWD prions. When we performed serial prion amplification in vitro using S96-PrPC, we observed a reduction in the efficiency of propagation with the Wisc-1 or CWD2 strains, suggesting these strains cannot stably template their conformations on this PrPC once the primary sequence has changed after the first round of replication. Our data shows the S96-PrPC polymorphism is detrimental to prion conversion of some CWD strains. These data suggests that deer homozygous for S96-PrPC may not sustain prion transmission as compared to a deer expressing G96-PrPC.
snip...
The protective effect of S96 and H95 alleles was further demonstrated by experimental oral infection in white-tailed deer expressing these amino acid substitutions19. Among the alleles of the PRNP gene associated with a lower CWD incidence and extended preclinical phase, S96 has the highest allelic frequency (~ 25%) after the wt allele in several white-tailed deer populations from the United States and Canada26,27,31. Subsequent independent transmission and epidemiological studies have demonstrated that deer homozygous and heterozygous for S96-PrPC are, compared to wt/wt deer, less susceptible to CWD infection, present prolonged survival times, show delayed prion accumulation and are generally at a significantly earlier stage of disease when deer herds are depopulated23,31,32,33.
Prion protein polymorphisms associated with reduced CWD susceptibility limit peripheral PrPCWD deposition in orally infected white-tailed deer
Alicia Otero1 , Camilo Duque Velásquez4,5, Chad Johnson3 , Allen Herbst2,5, Rosa Bolea1 , Juan José Badiola1 , Judd Aiken2,5 and Debbie McKenzie4,5*
Abstract
Background: Chronic wasting disease (CWD) is a prion disease affecting members of the Cervidae family. PrPC primary structures play a key role in CWD susceptibility resulting in extended incubation periods and regulating the propagation of CWD strains. We analyzed the distribution of abnormal prion protein (PrPCWD) aggregates in brain and peripheral organs from orally inoculated white-tailed deer expressing four different PRNP genotypes: Q95G96/ Q95G96 (wt/wt), S96/wt, H95/wt and H95/S96 to determine if there are substantial differences in the deposition pattern of PrPCWD between different PRNP genotypes.
Results: Although we detected differences in certain brain areas, globally, the different genotypes showed similar PrPCWD deposition patterns in the brain. However, we found that clinically affected deer expressing H95 PrPC , despite having the longest survival periods, presented less PrPCWD immunoreactivity in particular peripheral organs. In addition, no PrPCWD was detected in skeletal muscle of any of the deer.
Conclusions: Our data suggest that expression of H95-PrPC limits peripheral accumulation of PrPCWD as detected by immunohistochemistry. Conversely, infected S96/wt and wt/wt deer presented with similar PrPCWD peripheral distribution at terminal stage of disease, suggesting that the S96-PrPC allele, although delaying CWD progression, does not completely limit the peripheral accumulation of the infectious agent.
snip...
The significantly longer incubation periods observed in deer with H95-PRNP alleles may not impact secretion of CWD (i.e., less CWD secreted over longer time periods). The emergence of new CWD strains could implicate a zoonotic potential [20].
Keywords: Prions, Prion diseases, Chronic wasting disease, CWD, PrPCWD, Peripheral tissues, Polymorphisms, Deer
***> Selective Breeding
***> less susceptible to CWD infection, present prolonged survival times...
this is very disturbing. with all the hype about selective breeding with different alleles, and presenting longer survival times with cwd, this would only allow the spreading of the cwd tse prion to last longer in the given environment imo., and as such has been stated in scientific literature...terry
TUESDAY, MAY 11, 2021
A Unique Presentation of Creutzfeldt-Jakob Disease in a Patient Consuming Deer Antler Velvet
Conclusion
We believe that our patient’s case of CJD is highly suspicious for cervid etiology given the circumstances of the case as well as the strong evidence of plausibility reported in published literature. This is the first known case of CJD in a patient who had consumed deer antler velvet. Despite the confirmed diagnosis of CJD, a causal relationship between the patient’s disease and his consumption of deer antler velvet cannot be definitively concluded.
Supplemental data including molecular tissue sample analysis and autopsy findings could yield further supporting evidence. Given this patient’s clinical resemblance to CBD and the known histological similarities of CBD with CJD, clinicians should consider both diseases in the differential diagnosis of patients with a similarly esoteric presentation. Regardless of the origin of this patient’s disease, it is clear that the potential for prion transmission from cervids to humans should be further investigated by the academic community with considerable urgency.
''We believe that our patient’s case of CJD is highly suspicious for cervid etiology given the circumstances of the case as well as the strong evidence of plausibility reported in published literature. This is the first known case of CJD in a patient who had consumed deer antler velvet. Despite the confirmed diagnosis of CJD, a causal relationship between the patient’s disease and his consumption of deer antler velvet cannot be definitively concluded.''
ABOUT that deer antler spray and CWD TSE PRION...
I have been screaming this since my neighbors mom died from cjd, and she had been taking a supplement that contained bovine brain, bovine eyeball, and other SRMs specified risk materials, the most high risk for mad cow disease.
just saying...
I made a submission to the BSE Inquiry long ago during the BSE Inquiry days, and they seemed pretty interested.
Sender: "Patricia Cantos"
To: "Terry S Singeltary Sr. (E-mail)"
Subject: Your submission to the Inquiry
Date: Fri, 3 Jul 1998 10:10:05 +0100
3 July 1998
Mr Terry S Singeltary Sr.
E-Mail: Flounder at wt.net
Ref: E2979
Dear Mr Singeltary,
Thank you for your E-mail message of the 30th of June 1998 providing the Inquiry with your further comments.
Thank you for offering to provide the Inquiry with any test results on the nutritional supplements your mother was taking before she died.
As requested I am sending you our general Information Pack and a copy of the Chairman's letter. Please contact me if your system cannot read the attachments.
Regarding your question, the Inquiry is looking into many aspects of the scientific evidence on BSE and nvCJD. I would refer you to the transcripts of evidence we have already heard which are found on our internet site at ;
Could you please provide the Inquiry with a copy of the press article you refer to in your e-mail? If not an approximate date for the article so that we can locate it?
In the meantime, thank you for you comments. Please do not hesitate to contact me on...
snip...end...tss
everyone I tell this too gets it screwed up...MY MOTHER WAS NOT TAKING THOSE SUPPLEMENTS IPLEX (that I ever knew of). this was my neighbors mother that died exactly one year _previously_ and to the day of sporadic CJD that was diagnosed as Alzheimer’s at first. my mother died exactly a year later from the Heidenhain Variant of Creutzfeldt Jakob Disease hvCJD, and exceedingly rare strains of the ever growing sporadic CJD’s. _both_ cases confirmed. ...kind regards, terry
TSEs i.e. mad cow disease's BSE/BASE and NUTRITIONAL SUPPLEMENTS
IPLEX, mad by standard process;
vacuum dried bovine BRAIN, bone meal, bovine EYE, veal Bone, bovine liver powder, bovine adrenal, vacuum dried bovine kidney, and vacuum dried porcine stomach.
also;
what about potential mad cow candy bars ?
see their potential mad cow candy bar list too...
THESE are just a few of MANY of just this ONE COMPANY...TSS
DEPARTMENT OF HEALTH AND HUMAN SERVICES
FOOD AND DRUG ADMINISTRATION CENTER FOR BIOLOGICS EVALUATION AND RESEARCH
TRANSMISSIBLE SPONGIFORM ENCEPHALOPATHIES ADVISORY COMMITTEE
Friday, January 19, 2001 snip...
17 But I think that we could exhibit some quite
18 reasonable concern about blood donors who are taking dietary
19 supplements that contain a certain amount of unspecified-
20 origin brain, brain-related, brain and pituitary material.
21 If they have done this for more than a sniff or something
22 like that, then, perhaps, they should be deferred as blood
23 donors.
24 That is probably worse than spending six months in
25 the U.K.
1/19/01
3681t2.rtf(845) page 501
see full text ;
Saturday, May 1, 2021
Clinical Use of Improved Diagnostic Testing for Detection of Prion Disease
***Moreover, sporadic disease has never been observed in breeding colonies or primate research laboratories, most notably among hundreds of animals over several decades of study at the National Institutes of Health25, and in nearly twenty older animals continuously housed in our own facility.***
Even if the prevailing view is that sporadic CJD is due to the spontaneous formation of CJD prions, it remains possible that its apparent sporadic nature may, at least in part, result from our limited capacity to identify an environmental origin.
https://www.nature.com/articles/srep11573
O.05: Transmission of prions to primates after extended silent incubation periods: Implications for BSE and scrapie risk assessment in human populations
Emmanuel Comoy, Jacqueline Mikol, Valerie Durand, Sophie Luccantoni, Evelyne Correia, Nathalie Lescoutra, Capucine Dehen, and Jean-Philippe Deslys Atomic Energy Commission; Fontenay-aux-Roses, France
Prion diseases (PD) are the unique neurodegenerative proteinopathies reputed to be transmissible under field conditions since decades. The transmission of Bovine Spongiform Encephalopathy (BSE) to humans evidenced that an animal PD might be zoonotic under appropriate conditions. Contrarily, in the absence of obvious (epidemiological or experimental) elements supporting a transmission or genetic predispositions, PD, like the other proteinopathies, are reputed to occur spontaneously (atpical animal prion strains, sporadic CJD summing 80% of human prion cases).
Non-human primate models provided the first evidences supporting the transmissibiity of human prion strains and the zoonotic potential of BSE. Among them, cynomolgus macaques brought major information for BSE risk assessment for human health (Chen, 2014), according to their phylogenetic proximity to humans and extended lifetime. We used this model to assess the zoonotic potential of other animal PD from bovine, ovine and cervid origins even after very long silent incubation periods.
*** We recently observed the direct transmission of a natural classical scrapie isolate to macaque after a 10-year silent incubation period,
***with features similar to some reported for human cases of sporadic CJD, albeit requiring fourfold long incubation than BSE. Scrapie, as recently evoked in humanized mice (Cassard, 2014),
***is the third potentially zoonotic PD (with BSE and L-type BSE),
***thus questioning the origin of human sporadic cases.
We will present an updated panorama of our different transmission studies and discuss the implications of such extended incubation periods on risk assessment of animal PD for human health.
===============
***thus questioning the origin of human sporadic cases***
===============
***our findings suggest that possible transmission risk of H-type BSE to sheep and human. Bioassay will be required to determine whether the PMCA products are infectious to these animals.
==============
https://prion2015.files.wordpress.com/2015/05/prion2015abstracts.pdf
***Transmission data also revealed that several scrapie prions propagate in HuPrP-Tg mice with efficiency comparable to that of cattle BSE. While the efficiency of transmission at primary passage was low, subsequent passages resulted in a highly virulent prion disease in both Met129 and Val129 mice.
***Transmission of the different scrapie isolates in these mice leads to the emergence of prion strain phenotypes that showed similar characteristics to those displayed by MM1 or VV2 sCJD prion.
***These results demonstrate that scrapie prions have a zoonotic potential and raise new questions about the possible link between animal and human prions.
http://www.tandfonline.com/doi/abs/10.1080/19336896.2016.1163048?journalCode=kprn20
Prion diseases (PD) are the unique neurodegenerative proteinopathies reputed to be transmissible under field conditions since decades. The transmission of Bovine Spongiform Encephalopathy (BSE) to humans evidenced that an animal PD might be zoonotic under appropriate conditions. Contrarily, in the absence of obvious (epidemiological or experimental) elements supporting a transmission or genetic predispositions, PD, like the other proteinopathies, are reputed to occur spontaneously (atpical animal prion strains, sporadic CJD summing 80% of human prion cases).
Non-human primate models provided the first evidences supporting the transmissibiity of human prion strains and the zoonotic potential of BSE. Among them, cynomolgus macaques brought major information for BSE risk assessment for human health (Chen, 2014), according to their phylogenetic proximity to humans and extended lifetime. We used this model to assess the zoonotic potential of other animal PD from bovine, ovine and cervid origins even after very long silent incubation periods.
*** We recently observed the direct transmission of a natural classical scrapie isolate to macaque after a 10-year silent incubation period,
***with features similar to some reported for human cases of sporadic CJD, albeit requiring fourfold long incubation than BSE. Scrapie, as recently evoked in humanized mice (Cassard, 2014),
***is the third potentially zoonotic PD (with BSE and L-type BSE),
***thus questioning the origin of human sporadic cases.
We will present an updated panorama of our different transmission studies and discuss the implications of such extended incubation periods on risk assessment of animal PD for human health.
===============
***thus questioning the origin of human sporadic cases***
===============
***our findings suggest that possible transmission risk of H-type BSE to sheep and human. Bioassay will be required to determine whether the PMCA products are infectious to these animals.
==============
https://prion2015.files.wordpress.com/2015/05/prion2015abstracts.pdf
***Transmission data also revealed that several scrapie prions propagate in HuPrP-Tg mice with efficiency comparable to that of cattle BSE. While the efficiency of transmission at primary passage was low, subsequent passages resulted in a highly virulent prion disease in both Met129 and Val129 mice.
***Transmission of the different scrapie isolates in these mice leads to the emergence of prion strain phenotypes that showed similar characteristics to those displayed by MM1 or VV2 sCJD prion.
***These results demonstrate that scrapie prions have a zoonotic potential and raise new questions about the possible link between animal and human prions.
http://www.tandfonline.com/doi/abs/10.1080/19336896.2016.1163048?journalCode=kprn20
PRION 2016 TOKYO
Saturday, April 23, 2016
SCRAPIE WS-01: Prion diseases in animals and zoonotic potential 2016
Prion. 10:S15-S21. 2016 ISSN: 1933-6896 printl 1933-690X online
Taylor & Francis
Prion 2016 Animal Prion Disease Workshop Abstracts
WS-01: Prion diseases in animals and zoonotic potential
Transmission of the different scrapie isolates in these mice leads to the emergence of prion strain phenotypes that showed similar characteristics to those displayed by MM1 or VV2 sCJD prion.
These results demonstrate that scrapie prions have a zoonotic potential and raise new questions about the possible link between animal and human prions.
http://www.tandfonline.com/doi/abs/10.1080/19336896.2016.1163048?journalCode=kprn20
Title: Transmission of scrapie prions to primate after an extended silent incubation period)
*** In complement to the recent demonstration that humanized mice are susceptible to scrapie, we report here the first observation of direct transmission of a natural classical scrapie isolate to a macaque after a 10-year incubation period. Neuropathologic examination revealed all of the features of a prion disease: spongiform change, neuronal loss, and accumulation of PrPres throughout the CNS.
*** This observation strengthens the questioning of the harmlessness of scrapie to humans, at a time when protective measures for human and animal health are being dismantled and reduced as c-BSE is considered controlled and being eradicated.
*** Our results underscore the importance of precautionary and protective measures and the necessity for long-term experimental transmission studies to assess the zoonotic potential of other animal prion strains.
http://www.ars.usda.gov/research/publications/publications.htm?SEQ_NO_115=313160
3.2.1.2 Non‐cervid domestic species
The remarkably high rate of natural CWD transmission in the ongoing NA epidemics raises the question of the risk to livestock grazing on CWD‐contaminated shared rangeland and subsequently developing a novel CWD‐related prion disease. This issue has been investigated by transmitting CWD via experimental challenge to cattle, sheep and pigs and to tg mouse lines expressing the relevant species PrP.
For cattle challenged with CWD, PrPSc was detected in approximately 40% of intracerebrally inoculated animals (Hamir et al., 2005, 2006a, 2007). Tg mice expressing bovine PrP have also been challenged with CWD and while published studies have negative outcomes (Tamguney et al., 2009b), unpublished data provided for the purposes of this Opinion indicate that some transmission of individual isolates to bovinised mice is possible (Table 1).
In small ruminant recipients, a low rate of transmission was reported between 35 and 72 months post‐infection (mpi) in ARQ/ARQ and ARQ/VRQ sheep intracerebrally challenged with mule deer CWD (Hamir et al., 2006b), while two out of two ARQ/ARQ sheep intracerebrally inoculated with elk CWD developed clinical disease after 28 mpi (Madsen‐Bouterse et al., 2016). However, tg mice expressing ARQ sheep PrP were resistant (Tamguney et al., 2006) and tg mice expressing the VRQ PrP allele were poorly susceptible to clinical disease (Beringue et al., 2012; Madsen‐Bouterse et al., 2016). In contrast, tg mice expressing VRQ sheep PrP challenged with CWD have resulted in highly efficient, life‐long asymptomatic replication of these prions in the spleen tissue (Beringue et al., 2012).
A recent study investigated the potential for swine to serve as hosts of the CWD agent(s) by intracerebral or oral challenge of crossbred piglets (Moore et al., 2016b, 2017). Pigs sacrificed at 6 mpi, approximately the age at which pigs reach market weight, were clinically healthy and negative by diagnostic tests, although low‐level CWD agent replication could be detected in the CNS by bioassay in tg cervinised mice. Among pigs that were incubated for up to 73 mpi, some gave diagnostic evidence of CWD replication in the brain between 42 and 72 mpi. Importantly, this was observed also in one orally challenged pig at 64 mpi and the presence of low‐level CWD replication was confirmed by mouse bioassay. The authors of this study argued that pigs can support low‐level amplification of CWD prions, although the species barrier to CWD infection is relatively high and that the detection of infectivity in orally inoculated pigs with a mouse bioassay raises the possibility that naturally exposed pigs could act as a reservoir of CWD infectivity.
1: J Infect Dis 1980 Aug;142(2):205-8
Oral transmission of kuru, Creutzfeldt-Jakob disease, and scrapie to nonhuman primates.
Gibbs CJ Jr, Amyx HL, Bacote A, Masters CL, Gajdusek DC.
Kuru and Creutzfeldt-Jakob disease of humans and scrapie disease of sheep and goats were transmitted to squirrel monkeys (Saimiri sciureus) that were exposed to the infectious agents only by their nonforced consumption of known infectious tissues. The asymptomatic incubation period in the one monkey exposed to the virus of kuru was 36 months; that in the two monkeys exposed to the virus of Creutzfeldt-Jakob disease was 23 and 27 months, respectively; and that in the two monkeys exposed to the virus of scrapie was 25 and 32 months, respectively. Careful physical examination of the buccal cavities of all of the monkeys failed to reveal signs or oral lesions. One additional monkey similarly exposed to kuru has remained asymptomatic during the 39 months that it has been under observation.
snip...
The successful transmission of kuru, Creutzfeldt-Jakob disease, and scrapie by natural feeding to squirrel monkeys that we have reported provides further grounds for concern that scrapie-infected meat may occasionally give rise in humans to Creutzfeldt-Jakob disease.
PMID: 6997404
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=6997404&dopt=Abstract
Recently the question has again been brought up as to whether scrapie is transmissible to man. This has followed reports that the disease has been transmitted to primates. One particularly lurid speculation (Gajdusek 1977) conjectures that the agents of scrapie, kuru, Creutzfeldt-Jakob disease and transmissible encephalopathy of mink are varieties of a single "virus". The U.S. Department of Agriculture concluded that it could "no longer justify or permit scrapie-blood line and scrapie-exposed sheep and goats to be processed for human or animal food at slaughter or rendering plants" (ARC 84/77)" The problem is emphasised by the finding that some strains of scrapie produce lesions identical to the once which characterise the human dementias"
Whether true or not. the hypothesis that these agents might be transmissible to man raises two considerations. First, the safety of laboratory personnel requires prompt attention. Second, action such as the "scorched meat" policy of USDA makes the solution of the scrapie problem urgent if the sheep industry is not to suffer grievously.
snip...
76/10.12/4.6
Nature. 1972 Mar 10;236(5341):73-4.
Transmission of scrapie to the cynomolgus monkey (Macaca fascicularis).
Gibbs CJ Jr, Gajdusek DC.
Nature 236, 73 - 74 (10 March 1972); doi:10.1038/236073a0
Transmission of Scrapie to the Cynomolgus Monkey (Macaca fascicularis)
C. J. GIBBS jun. & D. C. GAJDUSEK
National Institute of Neurological Diseases and Stroke, National Institutes of Health, Bethesda, Maryland
SCRAPIE has been transmitted to the cynomolgus, or crab-eating, monkey (Macaca fascicularis) with an incubation period of more than 5 yr from the time of intracerebral inoculation of scrapie-infected mouse brain. The animal developed a chronic central nervous system degeneration, with ataxia, tremor and myoclonus with associated severe scrapie-like pathology of intensive astroglial hypertrophy and proliferation, neuronal vacuolation and status spongiosus of grey matter. The strain of scrapie virus used was the eighth passage in Swiss mice (NIH) of a Compton strain of scrapie obtained as ninth intracerebral passage of the agent in goat brain, from Dr R. L. Chandler (ARC, Compton, Berkshire).
Wednesday, February 16, 2011
IN CONFIDENCE
SCRAPIE TRANSMISSION TO CHIMPANZEES
IN CONFIDENCE
reference...
RB3.20
TRANSMISSION TO CHIMPANZEES
1. Kuru and CJD have been successfully transmitted to chimpanzees but scrapie and TME have not.
2. We cannot say that scrapie will not transmit to chimpanzees. There are several scrapie strains and I am not aware that all have been tried (that would have to be from mouse passaged material). Nor has a wide enough range of field isolates subsequently strain typed in mice been inoculated by the appropriate routes (i/c, ilp and i/v) :
3. I believe the proposed experiment to determine transmissibility, if conducted, would only show the susceptibility or resistance of the chimpanzee to infection/disease by the routes used and the result could not be interpreted for the predictability of the susceptibility for man. Proposals for prolonged oral exposure of chimpanzees to milk from cattle were suggested a long while ago and rejected.
4. In view of Dr Gibbs' probable use of chimpazees Mr Wells' comments (enclosed) are pertinent. I have yet to receive a direct communication from Dr Schellekers but before any collaboration or provision of material we should identify the Gibbs' proposals and objectives.
5. A positive result from a chimpanzee challenged severely would likely create alarm in some circles even if the result could not be interpreted for man. I have a view that all these agents could be transmitted provided a large enough dose by appropriate routes was given and the animals kept long enough. Until the mechanisms of the species barrier are more clearly understood it might be best to retain that hypothesis.
6. A negative result would take a lifetime to determine but that would be a shorter period than might be available for human exposure and it would still not answer the question regarding mans' susceptibility. In the meantime no doubt the negativity would be used defensively. It would however be counterproductive if the experiment finally became positive. We may learn more about public reactions following next Monday' s meeting.
R. Bradley
23 September 1990
CVO (+Mr Wells' comments)
Dr T W A Little
Dr B J Shreeve
90/9.23/1.1.
http://web.archive.org/web/20090506041740/http://www.bseinquiry.gov.uk/files/yb/1990/09/23001001.pdf
IN CONFIDENCE CHIMPANZEES
CODE 18-77 Reference RB3.46
Some further information that may assist in decision making has been gained by discussion with Dr Rosalind Ridley.
She says that careful study of Gajdusek's work shows no increased susceptibility of chimpanzees over New World Monkeys such as Squirrel Monkeys. She does not think it would tell you anything about the susceptibility to man. Also Gajdusek did not, she believes, challenge chimpanzees with scrapie as severely as we did pigs and we know little of that source of scrapie. Comparisons would be difficult. She also would not expect the Home Office to sanction such experiments here unless there was a very clear and important objective that would be important for human health protection. She doubted such a case could be made. If this is the case she thought it would be unethical to do an experiment abroad because we could not do it in our own country.
Retrospectively she feels they should have put up more marmosets than they did. They all remain healthy. They would normally regard the transmission as negative if no disease resulted in five years.
We are not being asked for a decision but I think that before we made one we should gain as much knowledge as we can. If we decided to proceed we would have to bear any criticisms for many years if there was an adverse view by scientists ormedia. This should not be undertaken lightly. There is already some adverse comment here, I gather, on the pig experiment though that will subside.
The Gibbs' (as' distinct from Schellekers') study is somewhat different. We are merely supplying material for comparative studies in a laboratory with the greatest experience of human SEs in the world and it has been sanctioned by USDA (though we do not know for certain yet if chimpanzees specifically will be used). This would keep it at a lower profile than if we conducted such an experiment in the UK or Europe.
I consider we must have very powerful and defendable objectives to go beyond Gibbs' proposed experiments and should not initiate others just because an offer has been made.
Scientists have a responsibility to seek other methods of investigative research other than animal experimentation. At present no objective has convinced me we need to do research using Chimpanzees - a species in need of protection. Resisting such proposals would enable us to communicate that information to the scientist and the public should the need arise. A line would have been drawn.
CVO cc Dr T Dr B W A Little Dr B J Shreeve
R Bradley
26 September 1990
90/9.26/3.2
http://web.archive.org/web/20090506041605/http://www.bseinquiry.gov.uk/files/yb/1990/09/26003001.pdf
this is tse prion political theater here, i.e. what i call TSE PRION POKER...tss
3. Prof. A. Robertson gave a brief account of BSE. The US approach was to accord it a very low profile indeed. Dr. A Thiermann showed the picture in the ''Independent'' with cattle being incinerated and thought this was a fanatical incident to be avoided in the US at all costs.
snip...
PAGE 26
Transmission Studies
Mule deer transmissions of CWD were by intracerebral inoculation and compared with natural cases {the following was written but with a single line marked through it ''first passage (by this route)}....TSS
resulted in a more rapidly progressive clinical disease with repeated episodes of synocopy ending in coma. One control animal became affected, it is believed through contamination of inoculum (?saline). Further CWD transmissions were carried out by Dick Marsh into ferret, mink and squirrel monkey. Transmission occurred in ALL of these species with the shortest incubation period in the ferret.
The occurrence of CWD must be viewed against the contest of the locations in which it occurred. It was an incidental and unwelcome complication of the respective wildlife research programmes. Despite its subsequent recognition as a new disease of cervids, therefore justifying direct investigation, no specific research funding was forthcoming. The USDA veiwed it as a wildlife problem and consequently not their province! ...page 26.
snip...see;
IN CONFIDENCE
PERCEPTIONS OF UNCONVENTIONAL SLOW VIRUS DISEASE OF ANIMALS IN THE USA
GAH WELLS
REPORT OF A VISIT TO THE USA
APRIL-MAY 1989
Thursday, July 29, 2021
TSE PRION OCCUPATIONAL EXPOSURE VIA ANIMAL OR HUMAN, iatrogenic transmission, nvCJD or sCJD, what if?
Control of Chronic Wasting Disease OMB Control Number: 0579-0189 APHIS-2021-0004 Singeltary Submission
Docket No. APHIS-2018-0011 Chronic Wasting Disease Herd Certification
Sunday, January 10, 2021
APHIS Concurrence With OIE Risk Designation for Bovine Spongiform Encephalopathy [Docket No. APHIS-2018-0087] Singeltary Submission June 17, 2019
APHIS Concurrence With OIE Risk Designation for Bovine Spongiform Encephalopathy [Docket No. APHIS-2018-0087] Singeltary Submission
Greetings APHIS et al,
I would kindly like to comment on APHIS Concurrence With OIE Risk Designation for Bovine Spongiform Encephalopathy [Docket No. APHIS-2018-0087], and my comments are as follows, with the latest peer review and transmission studies as references of evidence.
THE OIE/USDA BSE Minimal Risk Region MRR is nothing more than free pass to import and export the Transmissible Spongiform Encephalopathy TSE Prion disease. December 2003, when the USDA et al lost it's supposedly 'GOLD CARD' ie BSE FREE STATUS (that was based on nothing more than not looking and not finding BSE), once the USA lost it's gold card BSE Free status, the USDA OIE et al worked hard and fast to change the BSE Geographical Risk Statuses i.e. the BSE GBR's, and replaced it with the BSE MRR policy, the legal tool to trade mad cow type disease TSE Prion Globally. The USA is doing just what the UK did, when they shipped mad cow disease around the world, except with the BSE MRR policy, it's now legal.
Also, the whole concept of the BSE MRR policy is based on a false pretense, that atypical BSE is not transmissible, and that only typical c-BSE is transmissible via feed. This notion that atypical BSE TSE Prion is an old age cow disease that is not infectious is absolutely false, there is NO science to show this, and on the contrary, we now know that atypical BSE will transmit by ORAL ROUTES, but even much more concerning now, recent science has shown that Chronic Wasting Disease CWD TSE Prion in deer and elk which is rampant with no stopping is sight in the USA, and Scrapie TSE Prion in sheep and goat, will transmit to PIGS by oral routes, this is our worst nightmare, showing even more risk factors for the USA FDA PART 589 TSE PRION FEED ban.
The FDA PART 589 TSE PRION FEED ban has failed terribly bad, and is still failing, since August 1997. there is tonnage and tonnage of banned potential mad cow feed that went into commerce, and still is, with one decade, 10 YEARS, post August 1997 FDA PART 589 TSE PRION FEED ban, 2007, with 10,000,000 POUNDS, with REASON, Products manufactured from bulk feed containing blood meal that was cross contaminated with prohibited meat and bone meal and the labeling did not bear cautionary BSE statement. you can see all these feed ban warning letters and tonnage of mad cow feed in commerce, year after year, that is not accessible on the internet anymore like it use to be, you can see history of the FDA failure August 1997 FDA PART 589 TSE PRION FEED ban here, but remember this, we have a new outbreak of TSE Prion disease in a new livestock species, the camel, and this too is very worrisome.
WITH the OIE and the USDA et al weakening the global TSE prion surveillance, by not classifying the atypical Scrapie as TSE Prion disease, and the notion that they want to do the same thing with typical scrapie and atypical BSE, it's just not scientific.
WE MUST abolish the BSE MRR policy, go back to the BSE GBR risk assessments by country, and enhance them to include all strains of TSE Prion disease in all species. With Chronic Wasting CWD TSE Prion disease spreading in Europe, now including, Norway, Finland, Sweden, also in Korea, Canada and the USA, and the TSE Prion in Camels, the fact the the USA is feeding potentially CWD, Scrapie, BSE, typical and atypical, to other animals, and shipping both this feed and or live animals or even grains around the globe, potentially exposed or infected with the TSE Prion. this APHIS Concurrence With OIE Risk Designation for Bovine Spongiform Encephalopathy [Docket No. APHIS-2018-0087], under it's present definition, does NOT show the true risk of the TSE Prion in any country. as i said, it's nothing more than a legal tool to trade the TSE Prion around the globe, nothing but ink on paper.
AS long as the BSE MRR policy stays in effect, TSE Prion disease will continued to be bought and sold as food for both humans and animals around the globe, and the future ramifications from friendly fire there from, i.e. iatrogenic exposure and transmission there from from all of the above, should not be underestimated. ...
Owens, Julie
From: Terry S. Singeltary Sr. [flounder9@verizon.net]
Sent: Monday, July 24, 2006 1:09 PM
To: FSIS Regulations Comments
Subject: [Docket No. FSIS-2006-0011] FSIS Harvard Risk Assessment of Bovine Spongiform Encephalopathy (BSE)
Page 1 of 98
8/3/2006
Greetings FSIS,
I would kindly like to comment on the following ;
MONDAY, NOVEMBER 16, 2015
Docket No. APHIS-2007-0127 Scrapie in Sheep and Goats Terry Singeltary Sr. Submission
Docket No. APHIS-2007-0127 Scrapie in Sheep and Goats Terry Singeltary Sr. Submission Docket No. APHIS-2007-0127
Scrapie in Sheep and Goats SUMMARY: We are reopening the comment period for our proposed rule that would revise completely the scrapie regulations, which concern the risk groups and categories established for individual animals and for flocks, the use of genetic testing as a means of assigning risk levels to animals, movement restrictions for animals found to be genetically less susceptible or resistant to scrapie, and record keeping requirements. This action will allow interested persons additional time to prepare and submit comments. DATES: The comment period for the proposed rule published on September 10, 2015 (80 FR 54660-54692) is reopened. We will consider all comments that we receive on or before December 9, 2015. ...
JAMA.2001; 285: 733-734. Vol. 285 No. 6, February 14, 2001 JAMA
Diagnosis and Reporting of Creutzfeldt-Jakob Disease Singeltary, Sr et al.
JAMA.2001; 285: 733-734. Vol. 285 No. 6, February 14, 2001 JAMA
Diagnosis and Reporting of Creutzfeldt-Jakob Disease
To the Editor: In their Research Letter, Dr Gibbons and colleagues1 reported that the annual US death rate due to Creutzfeldt-Jakob disease (CJD) has been stable since 1985. These estimates, however, are based only on reported cases, and do not include misdiagnosed or preclinical cases. It seems to me that misdiagnosis alone would drastically change these figures. An unknown number of persons with a diagnosis of Alzheimer disease in fact may have CJD, although only a small number of these patients receive the postmortem examination necessary to make this diagnosis. Furthermore, only a few states have made CJD reportable. Human and animal transmissible spongiform encephalopathies should be reportable nationwide and internationally..
Terry S. Singeltary, Sr Bacliff, Tex 1. Gibbons RV, Holman RC, Belay ED, Schonberger LB. Creutzfeldt-Jakob disease in the United States: 1979-1998. JAMA. 2000;284:2322-2323.
RE-Monitoring the occurrence of emerging forms of Creutzfeldt-Jakob disease in the United States
Terry S. Singeltary, retired (medically), CJD WATCH
Submitted March 26, 2003
I lost my mother to hvCJD (Heidenhain Variant CJD). I would like to comment on the CDC's attempts to monitor the occurrence of emerging forms of CJD. Asante, Collinge et al [1] have reported that BSE transmission to the 129-methionine genotype can lead to an alternate phenotype that is indistinguishable from type 2 PrPSc, the commonest sporadic CJD. However, CJD and all human TSEs are not reportable nationally. CJD and all human TSEs must be made reportable in every state and internationally. I hope that the CDC does not continue to expect us to still believe that the 85%+ of all CJD cases which are sporadic are all spontaneous, without route/source. We have many TSEs in the USA in both animal and man. CWD in deer/elk is spreading rapidly and CWD does transmit to mink, ferret, cattle, and squirrel monkey by intracerebral inoculation. With the known incubation periods in other TSEs, oral transmission studies of CWD may take much longer. Every victim/family of CJD/TSEs should be asked about route and source of this agent. To prolong this will only spread the agent and needlessly expose others. In light of the findings of Asante and Collinge et al, there should be drastic measures to safeguard the medical and surgical arena from sporadic CJDs and all human TSEs. I only ponder how many sporadic CJDs in the USA are type 2 PrPSc?
SPORADIC CJD LAYING ODDS
In brief
BMJ 2000; 320 doi: https://doi.org/10.1136/bmj.320.7226.8/b (Published 01 January 2000)
Cite this as: BMJ 2000;320:8
Rapid Response:
02 January 2000
Terry S Singeltary
retired
U.S. Scientist should be concerned with a CJD epidemic in the U.S., as well... In reading your short article about 'Scientist warn of CJD epidemic' news in brief Jan. 1, 2000. I find the findings in the PNAS old news, made famous again. Why is the U.S. still sitting on their butts, ignoring the facts? We have the beginning of a CJD epidemic in the U.S., and the U.S. Gov. is doing everything in it's power to conceal it.
The exact same recipe for B.S.E. existed in the U.S. for years and years. In reading over the Qualitative Analysis of BSE Risk Factors-1, this is a 25 page report by the USDA:APHIS:VS. It could have been done in one page. The first page, fourth paragraph says it all;
"Similarities exist in the two countries usage of continuous rendering technology and the lack of usage of solvents, however, large differences still remain with other risk factors which greatly reduce the potential risk at the national level."
Then, the next 24 pages tries to down-play the high risks of B.S.E. in the U.S., with nothing more than the cattle to sheep ratio count, and the geographical locations of herds and flocks. That's all the evidence they can come up with, in the next 24 pages.
Something else I find odd, page 16;
"In the United Kingdom there is much concern for a specific continuous rendering technology which uses lower temperatures and accounts for 25 percent of total output. This technology was _originally_ designed and imported from the United States. However, the specific application in the production process is _believed_ to be different in the two countries."
A few more factors to consider, page 15;
"Figure 26 compares animal protein production for the two countries. The calculations are based on slaughter numbers, fallen stock estimates, and product yield coefficients. This approach is used due to variation of up to 80 percent from different reported sources. At 3.6 million tons, the United States produces 8 times more animal rendered product than the United Kingdom."
"The risk of introducing the BSE agent through sheep meat and bone meal is more acute in both relative and absolute terms in the United Kingdom (Figures 27 and 28). Note that sheep meat and bone meal accounts for 14 percent, or 61 thousand tons, in the United Kingdom versus 0.6 percent or 22 thousand tons in the United States. For sheep greater than 1 year, this is less than one-tenth of one percent of the United States supply."
"The potential risk of amplification of the BSE agent through cattle meat and bone meal is much greater in the United States where it accounts for 59 percent of total product or almost 5 times more than the total amount of rendered product in the United Kingdom."
Considering, it would only take _one_ scrapie infected sheep to contaminate the feed. Considering Scrapie has run rampant in the U.S. for years, as of Aug. 1999, 950 scrapie infected flocks. Also, Considering only one quarter spoonful of scrapie infected material is lethal to a cow.
Considering all this, the sheep to cow ration is meaningless. As I said, it's 24 pages of B.S.e.
To be continued...
Terry S. Singeltary Sr.
Bacliff, Texas USA
Competing interests: No competing interests
Rapid response to:
US scientists develop a possible test for BSE
15 November 1999
Terry S Singeltary
NA
BMJ 1999; 319 doi: https://doi.org/10.1136/bmj.319.7220.1312b (Published 13 November 1999)
Cite this as: BMJ 1999;319:1312
Article Related content Article metrics
Rapid responses
Response Rapid Response: Re: vCJD in the USA * BSE in U.S. In reading the recent article in the BMJ about the potential BSE tests being developed in the U.S. and Bart Van Everbroeck reply. It does not surprize me, that the U.S. has been concealing vCJD. There have been people dying from CJD, with all the symptoms and pathological findings that resemble U.K. vCJD for some time. It just seems that when there is one found, they seem to change the clarical classification of the disease, to fit their agenda. I have several autopsies, stating kuru type amyloid plaques, one of the victims was 41 years of age. Also, my Mom died a most hideous death, Heidenhain Variant Creutzfeldt Jakob disease. Her symptoms resemble that of all the U.K. vCJD victims. She would jerk so bad at times, it would take 3 of us to hold her down, while she screamed "God, what's wrong with me, why can't I stop this." 1st of symptoms to death, 10 weeks, she went blind in the first few weeks. But, then they told me that this was just another strain of sporadic CJD. They can call it what ever they want, but I know what I saw, and what she went through. Sporadic, simply means, they do not know. My neighbors Mom also died from CJD. She had been taking a nutritional supplement which contained the following; vacuum dried bovine BRAIN, bone meal, bovine EYE, veal bone, bovine liver powder, bovine adrenal, vacuum dried bovine kidney, and vacuum dried porcine stomach. As I said, this woman taking these nutritional supplements, died from CJD. The particular batch of pills that was located, in which she was taking, was tested. From what I have heard, they came up negative, for the prion protein. But, in the same breath, they said their testing, may not have been strong enough to pick up the infectivity. Plus, she had been taking these type pills for years, so, could it have come from another batch?
CWD is just a small piece of a very big puzzle. I have seen while deer hunting, deer, squirrels and birds, eating from cattle feed troughs where they feed cattle, the high protein cattle by products, at least up until Aug. 4, 1997.
So why would it be so hard to believe that this is how they might become infected with a TSE. Or, even by potentially infected land. It's been well documented that it could be possible, from scrapie. Cats becoming infected with a TSE. Have you ever read the ingredients on the labels of cat and dog food? But, they do not put these tissues from these animals in pharmaceuticals, cosmetics, nutritional supplements, hGH, hPG, blood products, heart valves, and the many more products that come from bovine, ovine, or porcine tissues and organs. So, as I said, this CWD would be a small piece of a very big puzzle. But, it is here, and it most likely has killed. You see, greed is what caused this catastrophe, rendering and feeding practices. But, once Pandora's box was opened, the potential routes of infection became endless.
No BSE in the U.S.A.? I would not be so sure of that considering that since 1990;
Since 1990 the U.S. has raised 1,250,880,700 cattle;
Since 1990 the U.S. has ONLY checked 8,881 cattle brains for BSE, as of Oct. 4, 1999;
There are apprx. 100,000 DOWNER cattle annually in the U.S., that up until Aug. 4, 1997 went to the renders for feed;
Scrapie running rampant for years in the U.S., 950 infected FLOCKS, as of Aug. 1999;
Our feeding and rendering practices have mirrored that of the U.K. for years, some say it was worse. Everything from the downer cattle, to those scrapie infected sheep, to any roadkill, including the city police horse and the circus elephant went to the renders for feed and other products for consumption. Then they only implemented a partial feed ban on Aug. 4, 1997, but pigs, chickens, dogs, and cats, and humans were exempt from that ban. So they can still feed pigs and chickens those potentially TSE tainted by-products, and then they can still feed those by-products back to the cows. I believe it was Dr. Joe Gibbs, that said, the prion protein, can survive the digestinal track. So you have stopped nothing. It was proven in Oprah Winfrey's trial, that Cactus Cattle feeders, sent neurologically ill cattle, some with encephalopathy stamped on the dead slips, were picked up and sent to the renders, along with sheep carcasses. Speaking of autopsies, I have a stack of them, from CJD victims. You would be surprised of the number of them, who ate cow brains, elk brains, deer brains, or hog brains.
I believe all these TSE's are going to be related, and originally caused by the same greedy Industries, and they will be many. Not just the Renders, but you now see, that they are re-using medical devices that were meant for disposal. Some medical institutions do not follow proper auto- claving procedures (even Olympus has put out a medical warning on their endescopes about CJD, and the fact you cannot properly clean these instruments from TSE's), and this is just one product. Another route of infection.
Regardless what the Federal Government in the U.S. says. It's here, I have seen it, and the longer they keep sweeping it under the rug and denying the fact that we have a serious problem, one that could surpass aids (not now, but in the years to come, due to the incubation period), they will be responsible for the continued spreading of this deadly disease.
It's their move, it's CHECK, but once CHECKMATE has been called, how many thousands or millions, will be at risk or infected or even dead. You can't play around with these TSE's. I cannot stress that enough. They are only looking at body bags, and the fact the count is so low. But, then you have to look at the fact it is not a reportable disease in most states, mis-diagnosis, no autopsies performed. The fact that their one-in-a- million theory is a crude survey done about 5 years ago, that's a joke, under the above circumstances. A bad joke indeed........
The truth will come, but how many more have to die such a hideous death. It's the Government's call, and they need to make a serious move, soon. This problem, potential epidemic, is not going away, by itself.
Terry S. Singeltary Sr.
Bacliff, Texas 77518 USA
Competing interests: No competing interests
TUESDAY, AUGUST 03, 2021
USA Tables of Cases Examined National Prion Disease Pathology Surveillance Center Cases Examined July 9th, 2021
Wednesday, July 28, 2021
France issues moratorium on prion research after fatal brain disease strikes two lab workers
Thursday, July 29, 2021
TSE PRION OCCUPATIONAL EXPOSURE VIA ANIMAL OR HUMAN, iatrogenic transmission, nvCJD or sCJD, what if?
Alzheimer’s disease and Transmissible Spongiform Encephalopathy prion disease, Iatrogenic, what if ?
Posted by flounder on 05 Nov 2014 at 21:27 GMT
Self-Propagative Replication of Ab Oligomers Suggests Potential Transmissibility in Alzheimer Disease
*** Singeltary comment PLoS ***
Alzheimer’s disease and Transmissible Spongiform Encephalopathy prion disease, Iatrogenic, what if ?
Posted by flounder on 05 Nov 2014 at 21:27 GMT
=====prion 2018===
Prion Conference 2018
Sunday, February 25, 2018
PRION ROUND TABLE CONFERENCE 2018 MAY, 22-25 A REVIEW
Terry S. Singeltary Sr.
posted by Terry S. Singeltary Sr. at
2:15 PM
0 Comments:
Post a Comment
Subscribe to Post Comments [Atom]
<< Home