Friday, October 01, 2021

TEXAS CWD TSE PRION recent discoveries of new cases bring the total number of positive deer to 261 in 14 counties

TEXAS CWD TSE PRION recent discoveries of new cases bring the total number of positive deer to 261 in 14 counties

Biologists Remind Landowners and Hunters to Be Mindful of CWD Ahead of Deer Season 

Oct. 1, 2021 Media Contact: TPWD News, Business Hours, 512-389-8030 

AUSTIN – With the opening of deer season on the horizon, Texas Parks and Wildlife Department (TPWD) biologists are asking that hunters and landowners throughout the state be mindful of Chronic Wasting Disease (CWD) as new cases of the disease have been discovered in individual locations within multiple counties throughout Texas.

The new positive cases were found in a free-ranging mule deer in Lubbock County, as well as within seven captive deer breeding facilities in Hunt, Uvalde, Matagorda, Mason, and Duval counties. TPWD is concerned that CWD could have been introduced into free-ranging deer herds on properties that received deer from these deer breeding facilities where CWD positive animals were discovered. More than 1,700 deer were released to high fence pastures in 119 properties scattered across the state. These maps depict counties that contain properties where those deer were released and the number of potentially CWD exposed deer that were released by county.

The level of suspected risk for these properties that received released deer exposed to CWD is of significant concern to TPWD. The movement of live deer is readily accepted as the greatest risk of spreading CWD across the state. Eradication of CWD is very difficult if not impossible when established in free-ranging deer populations and in the environment. TPWD and the Texas Animal Health Commission (TAHC) have been working diligently to conduct epidemiological investigations and establish testing plans for those release sites in hopes of preventing CWD from becoming established in the free-ranging deer populations.

These recent discoveries of new cases bring the total number of CWD positive deer to 261 in 14 counties. To date, 168 of those positives are associated with captive breeding facilities, 25 from release sites associated with those positive captive breeding facilities, and 68 in free-ranging deer populations. Fifty-seven of the free-range positives are in the Trans Pecos and Texas panhandle, with the remaining 11 in Medina and Val Verde counties.

CWD surveillance of hunter-harvested deer, road-kills, and sick deer is critical for early detection and containment of the disease. Landowners and hunters play a critical role in managing CWD and are encouraged to report any tagged deer, or deer that appear to be sick or behaving strangely, to a TPWD biologist. Anyone hunting deer this season is encouraged to voluntarily provide samples for testing by taking deer to the nearest check station or by contacting a biologist in their area.

Learn more about CWD on the TPWD web site or the TAHC web site.


>>> These recent discoveries of new cases bring the total number of CWD positive deer to 261 in 14 counties. To date, 168 of those positives are associated with captive breeding facilities, 25 from release sites associated with those positive captive breeding facilities, and 68 in free-ranging deer populations. Fifty-seven of the free-range positives are in the Trans Pecos and Texas panhandle, with the remaining 11 in Medina and Val Verde counties. <<<

More than 30 white-tailed deer have tested positive from these facilities, which sparked a massive epidemiological investigation that has encompassed 181 trace breeding facilities and 119 release sites.



TUESDAY, AUGUST 31, 2021 

TEXAS CHRONIC WASTING DISEASE CWD TSE PRION HAS CONFIRMED 260 CASES TO DATE 

CWD Zone
Species
Total
Trans Pecos
Mule Deer - Free Range
34
Panhandle
Mule Deer - Free Range
17
Elk - Free Range
1
White-tailed Deer - Free Range
5
South-Central Texas
White-tailed Deer - Free Range
8
White-tailed Deer - Breeder Pen
149
White-tailed Deer - Breeder Release Site
20
Elk - Breeder Release Site
3
Red Deer - Breeder Release Site
2
Del Rio
White-tailed Deer - Free Range
3
Kimble County
White-tailed Deer - Breeder Pen
10
Northeast Texas
White-tailed Deer - Breeder Pen
5
Coastal Prairie
White-tailed Deer - Breeder Pen
1
Central Texas
White-tailed Deer - Breeder Pen
1
South Texas
White-tailed Deer - Breeder Pen
1
Grand Total
 
260

PERSONAL COMMUNICATION TPWD ET AL...terry

TUESDAY, AUGUST 31, 2021 

TEXAS CHRONIC WASTING DISEASE CWD TSE PRION HAS CONFIRMED 260 CASES TO DATE


RE: TAHC Chapter 40, Chronic Wasting Disease Terry Singeltary Comment Submission

Mr. Singeltary,

This email is to acknowledge receipt of your proposed rule comments. Thank you for your interest and participation in the Texas Animal Health Commission’s rulemaking process.

Sincerely,
Amanda

Amanda Bernhard
Assistant to the Executive Director
Texas Animal Health Commission
512-719-0704

From: Terry Singeltary <flounder9@verizon.net>
Sent: Wednesday, August 11, 2021 12:26 PM
Cc: General Counsel <gencounsel@tahc.texas.gov>
Subject: TAHC Chapter 40, Chronic Wasting Disease Terry Singeltary Comment Submission

Subject: TAHC Chapter 40, Chronic Wasting Disease Terry Singeltary Comment Submission

TAHC Chapter 40, Chronic Wasting Disease Terry Singeltary Comment Submission

WEDNESDAY, AUGUST 11, 2021 
 
TAHC Chapter 40, Chronic Wasting Disease Terry Singeltary Comment Submission
 
 
The contents of this e-mail message and any attachments are confidential and are intended solely for the addressee(s). The information may also be legally privileged. This transmission is sent in trust, for the sole purpose of delivery to the intended recipient(s). If you have received this transmission in error, any use, reproduction or dissemination of this transmission is strictly prohibited. If you are not the intended recipient, please immediately notify the sender by reply e-mail or phone and delete this message and its attachments, if any.

-----Original Message-----

From: Terry Singeltary

To: comments

Sent: Fri, Dec 20, 2019 3:53 pm

Subject: Texas TAHC, Administrative Code, Title 4, Part 2, Chapter 40, Chronic Wasting Disease Amendments Open For Comment beginning December 20, 2019 thru January 20, 2020 Terry Singeltary Comments Submission


----Original Message----- 

From: Terry Singeltary <flounder9@verizon.net



Sent: Sat, Aug 8, 2020 4:39 pm 

Subject: TAHC Chapter 40, Chronic Wasting Disease Singeltary Comment Submission August 8, 2020

TAHC Chapter 40, Chronic Wasting Disease Singeltary Comment Submission August 8, 2020


Genes (Basel) . 2021 Sep 10;12(9):1396. doi: 10.3390/genes12091396.

Selective Breeding for Disease-Resistant PRNP Variants to Manage Chronic Wasting Disease in Farmed Whitetail Deer

Nicholas Haley 1, Rozalyn Donner 1, Kahla Merrett 1, Matthew Miller 1, Kristen Senior 1

Affiliations expand

PMID: 34573378 DOI: 10.3390/genes12091396

Abstract

Chronic wasting disease (CWD) is a fatal transmissible spongiform encephalopathy (TSE) of cervids caused by a misfolded variant of the normal cellular prion protein, and it is closely related to sheep scrapie. Variations in a host's prion gene, PRNP, and its primary protein structure dramatically affect susceptibility to specific prion disorders, and breeding for PRNP variants that prevent scrapie infection has led to steep declines in the disease in North American and European sheep. While resistant alleles have been identified in cervids, a PRNP variant that completely prevents CWD has not yet been identified. Thus, control of the disease in farmed herds traditionally relies on quarantine and depopulation. In CWD-endemic areas, depopulation of private herds becomes challenging to justify, leading to opportunities to manage the disease in situ. We developed a selective breeding program for farmed white-tailed deer in a high-prevalence CWD-endemic area which focused on reducing frequencies of highly susceptible PRNP variants and introducing animals with less susceptible variants. With the use of newly developed primers, we found that breeding followed predictable Mendelian inheritance, and early data support our project's utility in reducing CWD prevalence. This project represents a novel approach to CWD management, with future efforts building on these findings.

Keywords: CWD; PRNP; deer; prion; resistance; selective breeding; susceptibility.


In Moore et al., reindeer carrying allele E had longer survival-times following intracranial exposure [24]. In the same experiment, a reindeer with a genotype carrier of E, found dead without showing clinical signs ~13 months post-intracranial inoculation, had no histopathological lesions or PrPSc deposition at post-mortem examination.

snip...

Our data support the notion that PRNP genetic variation modulates CWD susceptibility rather than conferring complete resistance. This is in agreement with experimental observations of reindeer-developing CWD after intracranial inoculation regardless of PRNP genotype [24].


 Published: 27 May 2021

White-tailed deer S96 prion protein does not support stable in vitro propagation of most common CWD strains

Alicia Otero, Camilo Duque Velásquez, Judd Aiken & Debbie McKenzie 

Scientific Reports volume 11, Article number: 11193 (2021) Cite this article

923 Accesses

12 Altmetric

Metrics details

Abstract

PrPC variation at residue 96 (G/S) plays an important role in the epidemiology of chronic wasting disease (CWD) in exposed white-tailed deer populations. In vivo studies have demonstrated the protective effect of serine at codon 96, which hinders the propagation of common CWD strains when expressed in homozygosis and increases the survival period of S96/wt heterozygous deer after challenge with CWD. Previous in vitro studies of the transmission barrier suggested that following a single amplification step, wt and S96 PrPC were equally susceptible to misfolding when seeded with various CWD prions. When we performed serial prion amplification in vitro using S96-PrPC, we observed a reduction in the efficiency of propagation with the Wisc-1 or CWD2 strains, suggesting these strains cannot stably template their conformations on this PrPC once the primary sequence has changed after the first round of replication. Our data shows the S96-PrPC polymorphism is detrimental to prion conversion of some CWD strains. These data suggests that deer homozygous for S96-PrPC may not sustain prion transmission as compared to a deer expressing G96-PrPC.

snip...

The protective effect of S96 and H95 alleles was further demonstrated by experimental oral infection in white-tailed deer expressing these amino acid substitutions19. Among the alleles of the PRNP gene associated with a lower CWD incidence and extended preclinical phase, S96 has the highest allelic frequency (~ 25%) after the wt allele in several white-tailed deer populations from the United States and Canada26,27,31. Subsequent independent transmission and epidemiological studies have demonstrated that deer homozygous and heterozygous for S96-PrPC are, compared to wt/wt deer, less susceptible to CWD infection, present prolonged survival times, show delayed prion accumulation and are generally at a significantly earlier stage of disease when deer herds are depopulated23,31,32,33.


Prion protein polymorphisms associated with reduced CWD susceptibility limit peripheral PrPCWD deposition in orally infected white-tailed deer

Alicia Otero1 , Camilo Duque Velásquez4,5, Chad Johnson3 , Allen Herbst2,5, Rosa Bolea1 , Juan José Badiola1 , Judd Aiken2,5 and Debbie McKenzie4,5*

Abstract

Background: Chronic wasting disease (CWD) is a prion disease affecting members of the Cervidae family. PrPC primary structures play a key role in CWD susceptibility resulting in extended incubation periods and regulating the propagation of CWD strains. We analyzed the distribution of abnormal prion protein (PrPCWD) aggregates in brain and peripheral organs from orally inoculated white-tailed deer expressing four different PRNP genotypes: Q95G96/ Q95G96 (wt/wt), S96/wt, H95/wt and H95/S96 to determine if there are substantial differences in the deposition pattern of PrPCWD between different PRNP genotypes.

Results: Although we detected differences in certain brain areas, globally, the different genotypes showed similar PrPCWD deposition patterns in the brain. However, we found that clinically affected deer expressing H95 PrPC , despite having the longest survival periods, presented less PrPCWD immunoreactivity in particular peripheral organs. In addition, no PrPCWD was detected in skeletal muscle of any of the deer.

Conclusions: Our data suggest that expression of H95-PrPC limits peripheral accumulation of PrPCWD as detected by immunohistochemistry. Conversely, infected S96/wt and wt/wt deer presented with similar PrPCWD peripheral distribution at terminal stage of disease, suggesting that the S96-PrPC allele, although delaying CWD progression, does not completely limit the peripheral accumulation of the infectious agent.

snip...

The significantly longer incubation periods observed in deer with H95-PRNP alleles may not impact secretion of CWD (i.e., less CWD secreted over longer time periods). The emergence of new CWD strains could implicate a zoonotic potential [20]. 

Keywords: Prions, Prion diseases, Chronic wasting disease, CWD, PrPCWD, Peripheral tissues, Polymorphisms, Deer



***> Selective Breeding

***> less susceptible to CWD infection, present prolonged survival times...

this is very disturbing. with all the hype about selective breeding with different alleles, and presenting longer survival times with cwd, this would only allow the spreading of the cwd tse prion to last longer in the given environment imo., and as such has been stated in scientific literature...terry



there is no question that feed can transmit cwd imo, thus, the voluntary feed ban for cwd animal protein should be MANDATORY ASAP!

Guidance for Industry

Use of Material from Deer and Elk in Animal Feed

This guidance represents the current thinking of the Food and Drug Administration (FDA or Agency) on this topic. It does not establish any rights for any person and is not binding on FDA or the public. END (see below)...

ORAL TRANSMISSION OF CWD TO DEER

Very low oral exposure to prions of brain or saliva origin can transmit chronic wasting disease

Nathaniel D. Denkers ,Clare E. Hoover ,Kristen A. Davenport,Davin M. Henderson,Erin E. McNulty,Amy V. Nalls,Candace K. Mathiason,Edward A. Hoover Published: August 20, 2020


Abstract

The minimum infectious dose required to induce CWD infection in cervids remains unknown, as does whether peripherally shed prions and/or multiple low dose exposures are important factors in CWD transmission. With the goal of better understand CWD infection in nature, we studied oral exposures of deer to very low doses of CWD prions and also examined whether the frequency of exposure or prion source may influence infection and pathogenesis. We orally inoculated white-tailed deer with either single or multiple divided doses of prions of brain or saliva origin and monitored infection by serial longitudinal tissue biopsies spanning over two years. We report that oral exposure to as little as 300 nanograms (ng) of CWD-positive brain or to saliva containing seeding activity equivalent to 300 ng of CWD-positive brain, were sufficient to transmit CWD disease. This was true whether the inoculum was administered as a single bolus or divided as three weekly 100 ng exposures. However, when the 300 ng total dose was apportioned as 10, 30 ng doses delivered over 12 weeks, no infection occurred. While low-dose exposures to prions of brain or saliva origin prolonged the time from inoculation to first detection of infection, once infection was established, we observed no differences in disease pathogenesis. These studies suggest that the CWD minimum infectious dose approximates 100 to 300 ng CWD-positive brain (or saliva equivalent), and that CWD infection appears to conform more with a threshold than a cumulative dose dynamic.

SNIP...

In conclusion, we have attempted to model and better understand CWD infection relative to natural exposure. The results demonstrate: (a) that the minimum CWD oral infectious dose is vastly lower than historical studies used to establish infection; (b) that a direct relationship exists between dose and incubation time to first prion replication detection in tonsils, irrespective of genotype; (c) that a difference was not discernible between brain vs. saliva source prions in ability to establish infection or in resultant disease course; and (d) that the CWD infection process appears to conform more to a threshold dose than an accumulative dose dynamic.


Research Paper

Experimental oral transmission of chronic wasting disease to sika deer (Cervus nippon)

Hyun-Joo Sohn ,Gordon Mitchell,Yoon Hee Lee,Hyo Jin Kim,Kyung-Je Park,Antanas Staskevicus, show all Pages 271-277 | Received 29 Jun 2020, Accepted 23 Nov 2020, Published online: 10 Dec 2020


ABSTRACT

Chronic wasting disease (CWD) affects a broad array of cervid species and continues to be detected in an expanding geographic range. Initially introduced into the Republic of Korea through the importation of CWD-infected elk (Cervus canadensis), additional cases of CWD were subsequently detected in farmed Korean elk and sika deer (Cervus nippon). Wild and farmed sika deer are found in many regions of Asia, North America, and Europe, although natural transmission to this species has not been detected outside of the Republic of Korea. In this study, the oral transmission of CWD to sika deer was investigated using material from CWD-affected elk. Pathological prion (PrPCWD) immunoreactivity was detected in oropharyngeal lymphoid tissues of one sika deer at 3.9 months post-inoculation (mpi) and was more widely distributed in a second sika deer examined at 10.9 mpi. The remaining four sika deer progressed to clinical disease between 21 and 24 mpi. Analysis of PrPCWD tissue distribution in clinical sika deer revealed widespread deposition in central and peripheral nervous systems, lymphoreticular tissues, and the gastrointestinal tract. Prion protein gene (PRNP) sequences of these sika deer were identical and consistent with those reported in natural sika deer populations. These findings demonstrate the efficient oral transmission of CWD from elk to sika deer.

SNIP...

Oral transmission of CWD from the brain tissues of infected elk to sika deer (Cervus nippon) occurred efficiently in all six sika deer inoculated in this study. PrPCWD was detected in tissues routinely collected for surveillance purposes (retropharyngeal lymph node and tonsil), using commercially available test methods, as early as 3.9 months after inoculation. Four of the six animals developed relatively comparable clinical symptoms and succumbed to disease within a mean period of 22 months. This incubation period is comparable to what has been reported in oral CWD inoculation studies in red deer [19] and elk homozygous for methionine at codon 132 [20], both species which are phylogenetically closely related to sika deer [21]. The progressive accumulation of PrPCWD in lymphoreticular and nervous system tissues was generally consistent with disease progression in other cervids infected naturally or experimentally with CWD [22].

SNIP...

Widespread detection of PrPCWD by IHC suggests that infectivity is distributed throughout a broad range of tissues in sika deer with clinical CWD, indicating the potential for transmission to other cervid species, and human exposure during the processing and consumption of infected animals. The early presence of PrPCWD in peripheral lymphoid tissues reflects the progressive accumulation pattern observed in other cervids and it seems reasonable to expect infectivity to be shed through similar routes such as feces, urine and saliva. PRNP polymorphisms associated with CWD resistance in other cervids were not present in the sika deer of this study, and the influence of other sika deer PRNP polymorphisms remains to be determined. Farmed and feral sika deer populations are distributed throughout the world and should be considered susceptible to CWD during the application of surveillance and control strategies.


Experimental oral transmission of chronic wasting disease to red deer (Cervus elaphus elaphus): Early detection and late stage distribution of protease-resistant prion protein

Aru Balachandran, Noel P. Harrington, James Algire, Andrei Soutyrine, Terry R. Spraker, Martin Jeffrey, Lorenzo González, Katherine I. O’Rourke

Abstract — Chronic wasting disease (CWD), an important emerging prion disease of cervids, is readily transmitted by intracerebral or oral inoculation from deer-to-deer and elk-to-elk, suggesting the latter is a natural route of exposure. Studies of host range susceptibility to oral infection, particularly of those species found in habitats where CWD currently exists are imperative. This report describes the experimental transmission of CWD to red deer following oral inoculation with infectious CWD material of elk origin. At 18 to 20 months post-inoculation, mild to moderate neurological signs and weight loss were observed and animals were euthanized and tested using 3 conventional immunological assays. The data indicate that red deer are susceptible to oral challenge and that tissues currently used for CWD diagnosis show strong abnormal prion (PrPCWD) accumulation. Widespread peripheral PrPCWD deposition involves lymphoreticular tissues, endocrine tissues, and cardiac muscle and suggests a potential source of prion infectivity, a means of horizontal transmission and carrier state.

SNIP...

In summary, this study demonstrates the potential for oral transmission of CWD to red deer and describes the pattern of PrPCWD accumulation for this species. The current surveillance testing regime for cervids would be expected to identify CWD-infected red deer should it occur in North America. These results confirm the usefulness of rapid tests such as ELISA but with generally slightly lower sensitivity when compared with IHC when testing tissues with patchy or sporadic PrPCWD deposition. The finding of PrPCWD in several extraneural tissues including cardiac muscle and the endocrine system suggests that further investigation and monitoring of the potential transmissibility to other species including humans is warranted.


Experimental Oral Transmission of Chronic Wasting Disease to Reindeer (Rangifer tarandus tarandus)

Gordon B. Mitchell,Christina J. Sigurdson,Katherine I. O’Rourke,James Algire,Noel P. Harrington,Ines Walther,Terry R. Spraker,Aru Balachandran 

Published: June 18, 2012


Abstract

Chronic wasting disease (CWD), a transmissible spongiform encephalopathy of cervids, remains prevalent in North American elk, white-tailed deer and mule deer. A natural case of CWD in reindeer (Rangifer tarandus tarandus) has not been reported despite potential habitat overlap with CWD-infected deer or elk herds. This study investigates the experimental transmission of CWD from elk or white-tailed deer to reindeer by the oral route of inoculation. Ante-mortem testing of the three reindeer exposed to CWD from white-tailed deer identified the accumulation of pathological PrP (PrPCWD) in the recto-anal mucosa associated lymphoid tissue (RAMALT) of two reindeer at 13.4 months post-inoculation. Terminal CWD occurred in the two RAMALT-positive reindeer at 18.5 and 20 months post-inoculation while one other reindeer in the white-tailed deer CWD inoculum group and none of the 3 reindeer exposed to elk CWD developed disease. Tissue distribution analysis of PrPCWD in CWD-affected reindeer revealed widespread deposition in central and peripheral nervous systems, lymphoreticular tissues, the gastrointestinal tract, neuroendocrine tissues and cardiac muscle. Analysis of prion protein gene (PRNP) sequences in the 6 reindeer identified polymorphisms at residues 2 (V/M), 129 (G/S), 138 (S/N) and 169 (V/M). These findings demonstrate that (i) a sub-population of reindeer are susceptible to CWD by oral inoculation implicating the potential for transmission to other Rangifer species, and (ii) certain reindeer PRNP polymorphisms may be protective against CWD infection.


Fox KA, Jewell JE, Williams ES, Miller MW. 2006. 

***> Patterns of PrPCWD accumulation during the course of chronic wasting disease infection in orally inoculated mule deer (Odocoileus hemionus). 

J. Gen. Virol. 87:3451–3461.

Hamir AN, Gidlewski T, Spraker TR, Miller JM, Creekmore L, Crocheck M, Cline T, O’Rourke KI. 2006. 

***> Preliminary observations of genetic susceptibility of elk (Cervus elaphus nelsoni) to chronic wasting disease by experimental oral inoculation. 

J. Vet. Diagn. Invest. 18:110 –114.

Kreeger TJ, Montgomery DL, Jewell JE, Schultz W, Williams ES. 2006.

***> Oral transmission of chronic wasting disease in captive Shira’s moose. 

J. Wildl. Dis. 42:640 –645.

Seelig DM, Mason GL, Telling GC, Hoover EA. 2010. 

***> Pathogenesis of chronic wasting disease in cervidized transgenic mice. 

Am. J. Pathol. 176: 2785–2797.

Sigurdson CJ, Williams ES, Miller MW, Spraker TR, O’Rourke KI, Hoover EA. 1999. 

***> Oral transmission and early lymphoid tropism of chronic wasting disease PrPres in mule deer fawns (Odocoileus hemionus). 

J. Gen. Virol. 80(Part 10):2757–2764.

Trifilo MJ, Ying G, Teng C, Oldstone MB. 2007. 

***> Chronic wasting disease of deer and elk in transgenic mice: oral transmission and pathobiology.

Virology 365:136 –143 

=====end=====

 ***> 6th America BSE 589.2001 FEED REGULATIONS CWD TSE Prion <***

so far, we have been lucky. to date, with the science at hand, no cwd transmitted to cattle, that has been documented, TO DATE, WITH THE SCIENCE AT HAND, it's not to say it has not already happened, just like with zoonosis of cwd i.e. molecular transmission studies have shown that cwd transmission to humans would look like sporadic cjd, NOT nvCJD or what they call now vCJD. the other thing is virulence and or horizontal transmission. this is very concerning with the recent fact of what seems to be a large outbreak of a new tse prion disease in camels in Africa. there is much concern now with hay, straw, grains, and such, with the cwd tse prion endemic countries USA, Canada. what is of greatest concern is the different strains of cwd, and the virulence there from? this thing (cwd) keeps mutating to different strains, and to different species, the bigger the chance of one of these strains that WILL TRANSMIT TO CATTLE OR HUMANS, and that it is documented (i believe both has already occured imo with science to date). with that said, a few things to ponder, and i am still very concerned with, the animal feed. we now know from transmission studies that cwd and scrapie will transmit to pigs by oral routes. the atypical bse strains will transmit by oral routes. i don't mean to keep kicking a mad cow, just look at the science; 

***> cattle, pigs, sheep, cwd, tse, prion, oh my! 

***> In contrast, cattle are highly susceptible to white-tailed deer CWD and mule deer CWD in experimental conditions but no natural CWD infections in cattle have been reported (Sigurdson, 2008; Hamir et al., 2006). 

Sheep and cattle may be exposed to CWD via common grazing areas with affected deer but so far, appear to be poorly susceptible to mule deer CWD (Sigurdson, 2008). In contrast, cattle are highly susceptible to white-tailed deer CWD and mule deer CWD in experimental conditions but no natural CWD infections in cattle have been reported (Sigurdson, 2008; Hamir et al., 2006). It is not known how susceptible humans are to CWD but given that the prion can be present in muscle, it is likely that humans have been exposed to the agent via consumption of venison (Sigurdson, 2008). Initial experimental research suggests that human susceptibility to CWD is low and there may be a robust species barrier for CWD transmission to humans (Sigurdson, 2008), however the risk appetite for a public health threat may still find this level unacceptable. 



Friday, December 14, 2012 

DEFRA U.K. What is the risk of Chronic Wasting Disease CWD being introduced into Great Britain? A Qualitative Risk Assessment October 2012 

snip..... 

In the USA, under the Food and Drug Administration's BSE Feed Regulation (21 CFR 589.2000) most material (exceptions include milk, tallow, and gelatin) from deer and elk is prohibited for use in feed for ruminant animals. With regards to feed for non-ruminant animals, under FDA law, CWD positive deer may not be used for any animal feed or feed ingredients. For elk and deer considered at high risk for CWD, the FDA recommends that these animals do not enter the animal feed system. However, this recommendation is guidance and not a requirement by law. Animals considered at high risk for CWD include: 

1) animals from areas declared to be endemic for CWD and/or to be CWD eradication zones and 

2) deer and elk that at some time during the 60-month period prior to slaughter were in a captive herd that contained a CWD-positive animal. 

Therefore, in the USA, materials from cervids other than CWD positive animals may be used in animal feed and feed ingredients for non-ruminants. 

The amount of animal PAP that is of deer and/or elk origin imported from the USA to GB can not be determined, however, as it is not specified in TRACES. 

It may constitute a small percentage of the 8412 kilos of non-fish origin processed animal proteins that were imported from US into GB in 2011. 

Overall, therefore, it is considered there is a __greater than negligible risk___ that (nonruminant) animal feed and pet food containing deer and/or elk protein is imported into GB. 

There is uncertainty associated with this estimate given the lack of data on the amount of deer and/or elk protein possibly being imported in these products. 

snip..... 

36% in 2007 (Almberg et al., 2011). In such areas, population declines of deer of up to 30 to 50% have been observed (Almberg et al., 2011). In areas of Colorado, the prevalence can be as high as 30% (EFSA, 2011). The clinical signs of CWD in affected adults are weight loss and behavioural changes that can span weeks or months (Williams, 2005). In addition, signs might include excessive salivation, behavioural alterations including a fixed stare and changes in interaction with other animals in the herd, and an altered stance (Williams, 2005). These signs are indistinguishable from cervids experimentally infected with bovine spongiform encephalopathy (BSE). Given this, if CWD was to be introduced into countries with BSE such as GB, for example, infected deer populations would need to be tested to differentiate if they were infected with CWD or BSE to minimise the risk of BSE entering the human food-chain via affected venison. snip..... The rate of transmission of CWD has been reported to be as high as 30% and can approach 100% among captive animals in endemic areas (Safar et al., 2008). 

snip..... 

In summary, in endemic areas, there is a medium probability that the soil and surrounding environment is contaminated with CWD prions and in a bioavailable form. In rural areas where CWD has not been reported and deer are present, there is a greater than negligible risk the soil is contaminated with CWD prion. snip..... In summary, given the volume of tourists, hunters and servicemen moving between GB and North America, the probability of at least one person travelling to/from a CWD affected area and, in doing so, contaminating their clothing, footwear and/or equipment prior to arriving in GB is greater than negligible... For deer hunters, specifically, the risk is likely to be greater given the increased contact with deer and their environment. However, there is significant uncertainty associated with these estimates. 

snip..... 

Therefore, it is considered that farmed and park deer may have a higher probability of exposure to CWD transferred to the environment than wild deer given the restricted habitat range and higher frequency of contact with tourists and returning GB residents. 

snip..... 


***> READ THIS VERY, VERY, CAREFULLY, AUGUST 1997 MAD COW FEED BAN WAS A SHAM, AS I HAVE STATED SINCE 1997! 3 FAILSAFES THE FDA ET AL PREACHED AS IF IT WERE THE GOSPEL, IN TERMS OF MAD COW BSE DISEASE IN USA, AND WHY IT IS/WAS/NOT A PROBLEM FOR THE USA, and those are; 

BSE TESTING (failed terribly and proven to be a sham) 

BSE SURVEILLANCE (failed terribly and proven to be a sham) 

BSE 589.2001 FEED REGULATIONS (another colossal failure, and proven to be a sham) 

these are facts folks. trump et al just admitted it with the feed ban. 

see; 

FDA Reports on VFD Compliance 

John Maday 

August 30, 2019 09:46 AM VFD-Form 007 (640x427) 

Before and after the current Veterinary Feed Directive rules took full effect in January, 2017, the FDA focused primarily on education and outreach. ( John Maday ) Before and after the current Veterinary Feed Directive (VFD) rules took full effect in January, 2017, the FDA focused primarily on education and outreach to help feed mills, veterinarians and producers understand and comply with the requirements. Since then, FDA has gradually increased the number of VFD inspections and initiated enforcement actions when necessary. On August 29, FDA released its first report on inspection and compliance activities. The report, titled “Summary Assessment of Veterinary Feed Directive Compliance Activities Conducted in Fiscal Years 2016 – 2018,” is available online.


SUNDAY, SEPTEMBER 1, 2019 

***> FDA Reports on VFD Compliance <***

THURSDAY, SEPTEMBER 26, 2019 

Veterinary Biologics Guideline 3.32E: Guideline for minimising the risk of introducing transmissible spongiform encephalopathy prions and other infectious agents through veterinary biologics


U.S.A. 50 STATE BSE MAD COW CONFERENCE CALL Jan. 9, 2001

Subject: BSE--U.S. 50 STATE CONFERENCE CALL Jan. 9, 2001

Date: Tue, 9 Jan 2001 16:49:00 -0800

From: "Terry S. Singeltary Sr."

Reply-To: Bovine Spongiform Encephalopathy


snip...

[host Richard Barns] and now a question from Terry S. Singeltary of CJD Watch.

[TSS] yes, thank you, U.S. cattle, what kind of guarantee can you give for serum or tissue donor herds?

[no answer, you could hear in the back ground, mumbling and 'we can't. have him ask the question again.]

[host Richard] could you repeat the question?

[TSS] U.S. cattle, what kind of guarantee can you give for serum or tissue donor herds?

[not sure whom ask this] what group are you with?

[TSS] CJD Watch, my Mom died from hvCJD and we are tracking CJD world-wide.

[not sure who is speaking] could you please disconnect Mr. Singeltary

[TSS] you are not going to answer my question?

[not sure whom speaking] NO

snip...see full archive and more of this;


Contains Nonbinding Recommendations

2

Guidance for Industry

Use of Material from Deer and Elk

in Animal Feed

This guidance represents the current thinking of the Food and Drug Administration (FDA or Agency) on this topic. It does not establish any rights for any person and is not binding on FDA or the public. You can use an alternative approach if it satisfies the requirements of the applicable statutes and regulations. To discuss an alternative approach, contact the FDA office responsible for this guidance as listed on the title page.

I. Introduction

Under FDA’s BSE feed regulation (21 CFR 589.2000) most material from deer and elk is prohibited for use in feed for ruminant animals. This guidance document describes FDA’s recommendations regarding the use in all animal feed of all material from deer and elk that are positive for Chronic Wasting Disease (CWD) or are considered at high risk for CWD. The potential risks from CWD to humans or non-cervid animals such as poultry and swine are not well understood. However, because of recent recognition that CWD is spreading rapidly in white-tailed deer, and because CWD’s route of transmission is poorly understood, FDA is making recommendations regarding the use in animal feed of rendered materials from deer and elk that are CWD-positive or that are at high risk for CWD.

In general, FDA’s guidance documents do not establish legally enforceable responsibilities. Instead, guidances describe the Agency’s current thinking on a topic and should be viewed only as recommendations, unless specific regulatory or statutory requirements are cited. The use of the word should in Agency guidances means that something is suggested or recommended, but not required.

II. Background

CWD is a neurological (brain) disease of farmed and wild deer and elk that belong in the animal family cervidae (cervids). Only deer and elk are known to be susceptible to CWD by natural transmission. The disease has been found in farmed and wild mule deer, white-tailed deer, North American elk, and in farmed black-tailed deer. CWD belongs to a family of animal and human diseases called transmissible spongiform encephalopathies (TSEs). These include bovine spongiform encephalopathy (BSE or “mad cow” disease) in cattle; scrapie in sheep and goats; and classical and variant Creutzfeldt-Jakob diseases (CJD and vCJD) in humans. There is no known treatment for these diseases, and there is no vaccine to prevent them. In addition, although validated postmortem diagnostic tests are available, there are no validated diagnostic tests for CWD that can be used to test for the disease in live animals.

Contains Nonbinding Recommendations

3

III. Use in animal feed of material from CWD-positive deer and elk

Material from CWD-positive animals may not be used in any animal feed or feed ingredients. Pursuant to Sec. 402(a)(5) of the Federal Food, Drug, and Cosmetic Act, animal feed and feed ingredients containing material from a CWD-positive animal would be considered adulterated. FDA recommends that any such adulterated feed or feed ingredients be recalled or otherwise removed from the marketplace.

IV. Use in animal feed of material from deer and elk considered at high risk for CWD Deer and elk considered at high risk for CWD include: (1) animals from areas declared by State officials to be endemic for CWD and/or to be CWD eradication zones; and (2) deer and elk that at some time during the 60-month period immediately before the time of slaughter were in a captive herd that contained a CWD-positive animal.

FDA recommends that materials from deer and elk considered at high risk for CWD no longer be entered into the animal feed system. Under present circumstances, FDA is not recommending that feed made from deer and elk from a non-endemic area be recalled if a State later declares the area endemic for CWD or a CWD eradication zone. In addition, at this time, FDA is not recommending that feed made from deer and elk believed to be from a captive herd that contained no CWD-positive animals be recalled if that herd is subsequently found to contain a CWD-positive animal.

V. Use in animal feed of material from deer and elk NOT considered at high risk for CWD

FDA continues to consider materials from deer and elk NOT considered at high risk for CWD to be acceptable for use in NON-RUMINANT animal feeds in accordance with current agency regulations, 21 CFR 589.2000. Deer and elk not considered at high risk include: (1) deer and elk from areas not declared by State officials to be endemic for CWD and/or to be CWD eradication zones; and (2) deer and elk that were not at some time during the 60-month period immediately before the time of slaughter in a captive herd that contained a CWD-positive animal.

Sunday, March 20, 2016

Docket No. FDA-2003-D-0432 (formerly 03D-0186) Use of Material from Deer and Elk in Animal Feed ***UPDATED MARCH 2016*** Singeltary Submission



2003D-0186 Guidance for Industry: Use of Material From Deer and Elk In Animal Feed 

EMC 1 Terry S. Singeltary Sr. 

Vol #: 1 



Research Project: TRANSMISSION, DIFFERENTIATION, AND PATHOBIOLOGY OF TRANSMISSIBLE SPONGIFORM ENCEPHALOPATHIES Location: Virus and Prion Research

Title: Disease-associated prion protein detected in lymphoid tissues from pigs challenged with the agent of chronic wasting disease 

Author item MOORE, SARAH - Orise Fellow item Kunkle, Robert item KONDRU, NAVEEN - Iowa State University item MANNE, SIREESHA - Iowa State University item SMITH, JODI - Iowa State University item KANTHASAMY, ANUMANTHA - Iowa State University item WEST GREENLEE, M - Iowa State University item Greenlee, Justin Submitted to: Prion Publication Type: Abstract Only Publication Acceptance Date: 3/15/2017 Publication Date: N/A Citation: N/A Interpretive Summary:

Technical Abstract: Aims: Chronic wasting disease (CWD) is a naturally-occurring, fatal neurodegenerative disease of cervids. We previously demonstrated that disease-associated prion protein (PrPSc) can be detected in the brain and retina from pigs challenged intracranially or orally with the CWD agent. In that study, neurological signs consistent with prion disease were observed only in one pig: an intracranially challenged pig that was euthanized at 64 months post-challenge. The purpose of this study was to use an antigen-capture immunoassay (EIA) and real-time quaking-induced conversion (QuIC) to determine whether PrPSc is present in lymphoid tissues from pigs challenged with the CWD agent. 

Methods: At two months of age, crossbred pigs were challenged by the intracranial route (n=20), oral route (n=19), or were left unchallenged (n=9). At approximately 6 months of age, the time at which commercial pigs reach market weight, half of the pigs in each group were culled (<6 month challenge groups). The remaining pigs (>6 month challenge groups) were allowed to incubate for up to 73 months post challenge (mpc). The retropharyngeal lymph node (RPLN) was screened for the presence of PrPSc by EIA and immunohistochemistry (IHC). The RPLN, palatine tonsil, and mesenteric lymph node (MLN) from 6-7 pigs per challenge group were also tested using EIA and QuIC. 

Results: PrPSc was not detected by EIA and IHC in any RPLNs. All tonsils and MLNs were negative by IHC, though the MLN from one pig in the oral <6 month group was positive by EIA. PrPSc was detected by QuIC in at least one of the lymphoid tissues examined in 5/6 pigs in the intracranial <6 months group, 6/7 intracranial >6 months group, 5/6 pigs in the oral <6 months group, and 4/6 oral >6 months group. Overall, the MLN was positive in 14/19 (74%) of samples examined, the RPLN in 8/18 (44%), and the tonsil in 10/25 (40%). 

Conclusions: This study demonstrates that PrPSc accumulates in lymphoid tissues from pigs challenged intracranially or orally with the CWD agent, and can be detected as early as 4 months after challenge. CWD-infected pigs rarely develop clinical disease and if they do, they do so after a long incubation period. This raises the possibility that CWD-infected pigs could shed prions into their environment long before they develop clinical disease. Furthermore, lymphoid tissues from CWD-infected pigs could present a potential source of CWD infectivity in the animal and human food chains.



Research Project: Pathobiology, Genetics, and Detection of Transmissible Spongiform Encephalopathies Location: Virus and Prion Research

Title: The agent of chronic wasting disease from pigs is infectious in transgenic mice expressing human PRNP 

Author item MOORE, S - Orise Fellow item Kokemuller, Robyn item WEST-GREENLEE, M - Iowa State University item BALKEMA-BUSCHMANN, ANNE - Friedrich-Loeffler-institut item GROSCHUP, MARTIN - Friedrich-Loeffler-institut item Greenlee, Justin Submitted to: Prion Publication Type: Abstract Only Publication Acceptance Date: 5/10/2018 Publication Date: 5/22/2018 Citation: Moore, S.J., Kokemuller, R.D., West-Greenlee, M.H., Balkema-Buschmann, A., Groschup, M.H., Greenlee, J.J. 2018. The agent of chronic wasting disease from pigs is infectious in transgenic mice expressing human PRNP. Prion 2018, Santiago de Compostela, Spain, May 22-25, 2018. Paper No. WA15, page 44.

Interpretive Summary:

Technical Abstract: We have previously shown that the chronic wasting disease (CWD) agent from white-tailed deer can be transmitted to domestic pigs via intracranial or oral inoculation although with low attack rates and restricted PrPSc accumulation. The objective of this study was to assess the potential for cross-species transmission of pig-passaged CWD using bioassay in transgenic mice. Transgenic mice expressing human (Tg40), bovine (TgBovXV) or porcine (Tg002) PRNP were inoculated intracranially with 1% brain homogenate from a pig that had been intracranially inoculated with a pool of CWD from white-tailed deer. This pig developed neurological clinical signs, was euthanized at 64 months post-inoculation, and PrPSc was detected in the brain. Mice were monitored daily for clinical signs of disease until the end of the study. Mice were considered positive if PrPSc was detected in the brain using an enzyme immunoassay (EIA). In transgenic mice expressing porcine prion protein the average incubation period was 167 days post-inoculation (dpi) and 3/27 mice were EIA positive (attack rate = 11%). All 3 mice were found dead and clinical signs were not noted prior to death. One transgenic mouse expressing bovine prion protein was euthanized due to excessive scratching at 617 dpi and 2 mice culled at the end of the study at 700 dpi were EIA positive resulting in an overall attack rate of 3/16 (19%). None of the transgenic mice expressing human prion protein that died or were euthanized up to 769 dpi were EIA positive and at study end point at 800 dpi 2 mice had positive EIA results (overall attack rate = 2/20 = 10%). The EIA optical density (OD) readings for all positive mice were at the lower end of the reference range (positive mice range, OD = 0.266-0.438; test positive reference range, OD = 0.250-4.000). To the authors’ knowledge, cervid-derived CWD isolates have not been successfully transmitted to transgenic mice expressing human prion protein. The successful transmission of pig-passaged CWD to Tg40 mice reported here suggests that passage of the CWD agent through pigs results in a change of the transmission characteristics which reduces the transmission barrier of Tg40 mice to the CWD agent. If this biological behavior is recapitulated in the original host species, passage of the CWD agent through pigs could potentially lead to increased pathogenicity of the CWD agent in humans.


cwd scrapie pigs oral routes 

***> However, at 51 months of incubation or greater, 5 animals were positive by one or more diagnostic methods. Furthermore, positive bioassay results were obtained from all inoculated groups (oral and intracranial; market weight and end of study) suggesting that swine are potential hosts for the agent of scrapie. <*** 

>*** Although the current U.S. feed ban is based on keeping tissues from TSE infected cattle from contaminating animal feed, swine rations in the U.S. could contain animal derived components including materials from scrapie infected sheep and goats. These results indicating the susceptibility of pigs to sheep scrapie, coupled with the limitations of the current feed ban, indicates that a revision of the feed ban may be necessary to protect swine production and potentially human health. <*** 

***> Results: PrPSc was not detected by EIA and IHC in any RPLNs. All tonsils and MLNs were negative by IHC, though the MLN from one pig in the oral <6 month group was positive by EIA. PrPSc was detected by QuIC in at least one of the lymphoid tissues examined in 5/6 pigs in the intracranial <6 months group, 6/7 intracranial >6 months group, 5/6 pigs in the oral <6 months group, and 4/6 oral >6 months group. Overall, the MLN was positive in 14/19 (74%) of samples examined, the RPLN in 8/18 (44%), and the tonsil in 10/25 (40%). 

***> Conclusions: This study demonstrates that PrPSc accumulates in lymphoid tissues from pigs challenged intracranially or orally with the CWD agent, and can be detected as early as 4 months after challenge. CWD-infected pigs rarely develop clinical disease and if they do, they do so after a long incubation period. This raises the possibility that CWD-infected pigs could shed prions into their environment long before they develop clinical disease. Furthermore, lymphoid tissues from CWD-infected pigs could present a potential source of CWD infectivity in the animal and human food chains. 




Research Project: TRANSMISSION, DIFFERENTIATION, AND PATHOBIOLOGY OF TRANSMISSIBLE SPONGIFORM ENCEPHALOPATHIES Location: Virus and Prion Research

Title: Scrapie transmits to white-tailed deer by the oral route and has a molecular profile similar to chronic wasting disease

Author 

 item Greenlee, Justin item Moore, S - Orise Fellow item Smith, Jodi - Iowa State University item Kunkle, Robert item West Greenlee, M - Iowa State University Submitted to: American College of Veterinary Pathologists Meeting Publication Type: Abstract Only Publication Acceptance Date: 8/12/2015 Publication Date: N/A Citation: N/A

Interpretive Summary:

Technical Abstract: The purpose of this work was to determine susceptibility of white-tailed deer (WTD) to the agent of sheep scrapie and to compare the resultant PrPSc to that of the original inoculum and chronic wasting disease (CWD). We inoculated WTD by a natural route of exposure (concurrent oral and intranasal (IN); n=5) with a US scrapie isolate. All scrapie-inoculated deer had evidence of PrPSc accumulation. PrPSc was detected in lymphoid tissues at preclinical time points, and deer necropsied after 28 months post-inoculation had clinical signs, spongiform encephalopathy, and widespread distribution of PrPSc in neural and lymphoid tissues. Western blotting (WB) revealed PrPSc with 2 distinct molecular profiles. WB on cerebral cortex had a profile similar to the original scrapie inoculum, whereas WB of brainstem, cerebellum, or lymph nodes revealed PrPSc with a higher profile resembling CWD. Homogenates with the 2 distinct profiles from WTD with clinical scrapie were further passaged to mice expressing cervid prion protein and intranasally to sheep and WTD. In cervidized mice, the two inocula have distinct incubation times. Sheep inoculated intranasally with WTD derived scrapie developed disease, but only after inoculation with the inoculum that had a scrapie-like profile. The WTD study is ongoing, but deer in both inoculation groups are positive for PrPSc by rectal mucosal biopsy. In summary, this work demonstrates that WTD are susceptible to the agent of scrapie, two distinct molecular profiles of PrPSc are present in the tissues of affected deer, and inoculum of either profile readily passes to deer.


223. Scrapie in white-tailed deer: a strain of the CWD agent that efficiently transmits to sheep?

Justin J. Greenleea, Robyn D. Kokemullera, S. Jo Moorea and Heather West Greenleeb

aVirus and Prion Research Unit, National Animal Disease Center, USDA, Agricultural Research Service, Ames, IA, USA; bDepartment of Biomedical Sciences, Iowa State University College of Veterinary Medicine, Ames, IA, USA

CONTACT Justin J. Greenlee Justin.Greenlee@ars.usda.gov

ABSTRACT

Scrapie is a transmissible spongiform encephalopathy of sheep and goats that is associated with widespread accumulation of abnormal prion protein (PrPSc) in the central nervous and lymphoid tissues. Chronic wasting disease (CWD) is the natural prion disease of cervid species, and the tissue distribution of PrPSc in affected cervids is similar to scrapie in sheep. There are several lines of evidence that suggest that multiple strains of CWD exist, which may affect the agent’s potential to transmit to hosts of the same or different species. We inoculated white-tailed deer with the scrapie agent from ARQ/ARQ sheep, which resulted in 100% attack rates by either the intracranial or oronasal route of inoculation. When examining tissues from the brainstems or lymphoid tissues by traditional diagnostic methods such as immunohistochemistry or western blots, it is difficult to differentiate tissues from deer infected with scrapie from those infected with CWD. However, there are several important differences between tissues from scrapie-infected white-tailed deer (WTD scrapie) and those infected with CWD (WTD CWD). First, there are different patterns of PrPSc deposition in the brains of infected deer: brain tissues from deer with WTD scrapie had predominantly particulate and stellate immunoreactivity whereas those from deer with WTD-CWD had large aggregates and plaque-like deposits. Secondly, the incubation periods of WTD scrapie isolates are longer than CWD isolates in mice expressing cervid prion protein. Most notably, the transmission potential of these two isolates back to sheep is distinctly different. Attempts to transmit various CWD isolates to sheep by the oral or oronasal routes have been unsuccessful despite observation periods of up to 7 years. However, WTD scrapie efficiently transmitted back to sheep by the oronasal route. Upon transmission back to sheep, the WTD scrapie isolate exhibited different phenotypic properties when compared to the sheep receiving the original sheep scrapie inoculum including different genotype susceptibilities, distinct PrPSc deposition patterns, and much more rapid incubation periods in transgenic mice expressing the ovine prion protein. The scrapie agent readily transmits between sheep and deer after oronasal exposure. This could confound the identification of CWD strains in deer and the eradication of scrapie from sheep.


HERE IS A FIND EXAMPLE OF ONE MAD COW FEED BAN WARNING LETTER, 9 YEARS POST MAD COW FEED BAN...

e) "Big Jim’s" BBB Deer Ration, Big Buck Blend, Recall # V-104-6;

f) CO-OP 40% Hog Supplement Medicated Pelleted, Tylosin 100 grams/ton, 50 lb. bag, Recall # V-105-6;

g) Pig Starter Pell II, 18% W/MCDX Medicated 282020, Carbadox -- 0.0055%, Recall # V-106-6;

ALABAMA MAD COW FEED IN COMMERCE 2006 

RECALLS AND FIELD CORRECTIONS: VETERINARY MEDICINE -- CLASS II

______________________________ 

PRODUCT

a) CO-OP 32% Sinking Catfish, Recall # V-100-6;

b) Performance Sheep Pell W/Decox/A/N, medicated, net wt. 50 lbs, Recall # V-101-6;

c) Pro 40% Swine Conc Meal -- 50 lb, Recall # V-102-6;

d) CO-OP 32% Sinking Catfish Food Medicated, Recall # V-103-6;

e) "Big Jim’s" BBB Deer Ration, Big Buck Blend, Recall # V-104-6;

f) CO-OP 40% Hog Supplement Medicated Pelleted, Tylosin 100 grams/ton, 50 lb. bag, Recall # V-105-6;

g) Pig Starter Pell II, 18% W/MCDX Medicated 282020, Carbadox -- 0.0055%, Recall # V-106-6;

h) CO-OP STARTER-GROWER CRUMBLES, Complete Feed for Chickens from Hatch to 20 Weeks, Medicated, Bacitracin Methylene Disalicylate, 25 and 50 Lbs, Recall # V-107-6;

i) CO-OP LAYING PELLETS, Complete Feed for Laying Chickens, Recall # 108-6;

j) CO-OP LAYING CRUMBLES, Recall # V-109-6;

k) CO-OP QUAIL FLIGHT CONDITIONER MEDICATED, net wt 50 Lbs, Recall # V-110-6;

l) CO-OP QUAIL STARTER MEDICATED, Net Wt. 50 Lbs, Recall # V-111-6;

m) CO-OP QUAIL GROWER MEDICATED, 50 Lbs, Recall # V-112-6

CODE

Product manufactured from 02/01/2005 until 06/06/2006

RECALLING FIRM/MANUFACTURER

Alabama Farmers Cooperative, Inc., Decatur, AL, by telephone, fax, email and visit on June 9, 2006. FDA initiated recall is complete.

REASON

Animal and fish feeds which were possibly contaminated with ruminant based protein not labeled as "Do not feed to ruminants".

VOLUME OF PRODUCT IN COMMERCE

125 tons

DISTRIBUTION

AL and FL 

______________________________

PRODUCT

Bulk custom dairy feds manufactured from concentrates, Recall # V-113-6

CODE

All dairy feeds produced between 2/1/05 and 6/16/06 and containing H. J. Baker recalled feed products.

RECALLING FIRM/MANUFACTURER

Vita Plus Corp., Gagetown, MI, by visit beginning on June 21, 2006. Firm initiated recall is complete.

REASON

The feed was manufactured from materials that may have been contaminated with mammalian protein.

VOLUME OF PRODUCT IN COMMERCE

27,694,240 lbs

DISTRIBUTION

MI 

______________________________

PRODUCT

Bulk custom made dairy feed, Recall # V-114-6

CODE

None

RECALLING FIRM/MANUFACTURER

Burkmann Feeds LLC, Glasgow, KY, by letter on July 14, 2006. Firm initiated recall is ongoing.

REASON

Custom made feeds contain ingredient called Pro-Lak, which may contain ruminant derived meat and bone meal.

VOLUME OF PRODUCT IN COMMERCE

?????

DISTRIBUTION

KY

END OF ENFORCEMENT REPORT FOR AUGUST 2, 2006

###


oral transmission of cwd to cervid is easily transmitted, and now we know cwd will transmit to pigs orally.  

IT IS PARAMONT THAT THE FDA PART 589 TSE PRION FEED BAN LOOP HOLE STILL ALLOWING CERVID TO BE FED ANIMAL PROTEIN, SHOULD BE BANNED IMMEDIATELY ASAP! 

***> 7TH TRUCKING TRANSPORTING CERVID CHRONIC WASTING DISEASE TSE PRION VIOLATING THE LACEY ACT

TUESDAY, JANUARY 21, 2020 

***> 2004 European Commission Chronic wasting disease AND TISSUES THAT MIGHT CARRY A RISK FOR HUMAN FOOD AND ANIMAL FEED CHAINS REPORT UPDATED 2020

SNIP...

 In summary, lateral transmission, compounded by animal movements is the most important factor in the spread of CWD. Indirect transmission via environmental contamination may play a role in natural dynamics and persistence of the disease and thus exacerbates epidemics and may present an obstacle to eradicating CWD from infected premises. This possibility and other epidemiological uncertainties also present significant obstacles to eradicating CWD from wildlife.

SEE;


PLEASE SEE HISTORY OF TEXAS TRUCKING CWD TSE PRION DISEASE AT THE BOTTOM OF MY SUBMISSION, TOO LONG TO POST HERE.

MONDAY, MARCH 05, 2018 

TRUCKING AROUND AND SPREADING CHRONIC WASTING DISEASE CWD TSE PRION VIA MOVEMENT OF CERVID AND TRANSPORTATION VEHICLES


SATURDAY, JULY 09, 2016

Texas Intrastate – within state movement of all Cervid or Trucking Chronic Wasting Disease CWD TSE Prion Moratorium


***> 8TH ALL CAPTIVE FARMING CERVID OPERATIONS MUST BE INSURED TO PAY FOR ANY CLEAN UP OF CWD AND QUARANTINE THERE FROM FOR THE STATE, NO MORE ENTITLEMENT PROGRAM FOR CERVID GAME FARMING PAY TO PLAY FOR CWD TSE PRION OFF THE TAX PAYERS BACK.

***> 9TH ANY STATE WITH DOCUMENTED CWD, INTERSTATE, NATIONAL, AND INTERNATIONAL MOVEMENT OF ALL CERVID, AND ALL CERVID PRODUCTS MUST BE HALTED!

***> 10TH BAN THE SALE OF STRAW BRED BUCKS AND ALL CERVID SEMEN AND URINE PRODUCTS

TUESDAY, DECEMBER 31, 2019 

In Vitro detection of Chronic Wasting Disease (CWD) prions in semen and reproductive tissues of white tailed deer bucks (Odocoileus virginianus 

SUNDAY, AUGUST 02, 2015  

TEXAS CWD, Have you been ThunderStruck, deer semen, straw bred bucks, super ovulation, and the potential TSE Prion connection, what if? 


SUNDAY, FEBRUARY 16, 2020 

***> Jerking for Dollars, Are Texas Politicians and Legislators Masturbating Deer For Money, and likely spreading CWD TSE Prion? 


CAPTIVE FARMED CERVID SHOULD BE BANNED imo, TO SAVE THE WILD CERVID HERDS, OR AT LEAST, THE USDA/APHIS CERVID HERD CERTIFICATION PROGRAM SHOULD BE MADE MANDATORY, WITH REAL CWD TSE PRION CHANGES THAT CAN BE MADE AND THEN STRICTLY ENFORCED. CATERING TO THE CAPTIVE FARMED CERVID INDUSTRY IS HELPING THE SPREAD OF CWD TSE PRION, AND THIS MUST BE STOPPED, NO MORE VOLUNTARY ACTIONS, THEY DO NOT WORK!

WEDNESDAY, MARCH 13, 2019 

CWD, TSE, PRION, MATERNAL mother to offspring, testes, epididymis, seminal fluid, and blood
Subject: Prion 2019 Conference

See full Prion 2019 Conference Abstracts


***> 11th ALL CAPTIVE FARMED CERVID MUST BE CWD TSE PRION TESTED ANNUALLY AND BEFORE SALE

snip...end

TUESDAY, SEPTEMBER 07, 2021 

Atypical Bovine Spongiform Encephalopathy BSE OIE, FDA 589.2001 FEED REGULATIONS, and Ingestion Therefrom


TUESDAY, SEPTEMBER 21, 2021 

Detection of CWD prions in naturally infected white-tailed deer fetuses and gestational tissues by PMCA 



***> 1st and foremost your biggest problem is 'VOLUNTARY'! AS with the BSE 589.2001 FEED REGULATIONS, especially since it is still voluntary with cervid, knowing full well that cwd and scrapie will transmit to pigs by oral route. VOLUNTARY DOES NOT WORK! all animal products should be banned and be made mandatory, and the herd certification program should be mandatory, or you don't move cervid. IF THE CWD HERD CERTIFICATION IS NOT MANDATORY, it will be another colossal tse prion failure from the start.

***> 2nd USA should declare a Declaration of Extraordinary Emergency due to CWD, and all exports of cervid and cervid products must be stopped internationally, and there should be a ban of interstate movement of cervid, until a live cwd test is available.

***> 3rd Captive Farmed cervid ESCAPEES should be made mandatory to report immediately, and strict regulations for those suspect cwd deer that just happen to disappear. IF a cervid escapes and is not found, that farm should be indefinitely shut down, all movement, until aid MIA cervid is found, and if not ever found, that farm shut down permanently.

***> 4th Captive Farmed Cervid, INDEMNITY, NO MORE Federal indemnity program, or what i call, ENTITLEMENT PROGRAM for game farm industry. NO MORE BAIL OUTS FROM TAX PAYERS. if the captive industry can't buy insurance to protect not only themselves, but also their customers, and especially the STATE, from Chronic Wasting Disease CWD TSE Prion or what some call mad deer disease and harm therefrom, IF they can't afford to buy that insurance that will cover all of it, then they DO NOT GET A PERMIT to have a game farm for anything. This CWD TSE Prion can/could/has caused property values to fall from some reports in some places. roll the dice, how much is a state willing to lose?

***> 5th QUARANTINE OF ALL FARMED CAPTIVE, BREEDERS, URINE, ANTLER, VELVET, SPERM, OR ANY FACILITY, AND THEIR PRODUCTS, that has been confirmed to have Chronic Wasting Disease CWD TSE Prion, the QUARANTINE should be for 21 years due to science showing what scrapie can do. 5 years is NOT near long enough. see; Infectious agent of sheep scrapie may persist in the environment for at least 16 to 21 years.

***> 6th America BSE 589.2001 FEED REGULATIONS CWD TSE Prion

***> 7TH TRUCKING TRANSPORTING CERVID CHRONIC WASTING DISEASE TSE PRION VIOLATING THE LACEY ACT

***> 8TH ALL CAPTIVE FARMING CERVID OPERATIONS MUST BE INSURED TO PAY FOR ANY CLEAN UP OF CWD AND QUARANTINE THERE FROM FOR THE STATE, NO MORE ENTITLEMENT PROGRAM FOR CERVID GAME FARMING PAY TO PLAY FOR CWD TSE PRION OFF THE TAX PAYERS BACK.

***> 9TH ANY STATE WITH DOCUMENTED CWD, INTERSTATE, NATIONAL, AND INTERNATIONAL MOVEMENT OF ALL CERVID, AND ALL CERVID PRODUCTS MUST BE HALTED!

***> 10TH BAN THE SALE OF STRAW BRED BUCKS AND ALL CERVID SEMEN AND URINE PRODUCTS

***> 11th ALL CAPTIVE FARMED CERVID AND THEIR PRODUCTS MUST BE CWD TSE PRION TESTED ANNUALLY AND BEFORE SALE FOR CWD TSE PRION

SEE FULL SCIENCE REFERENCES AND REASONINGS ;

Control of Chronic Wasting Disease OMB Control Number: 0579-0189 APHIS-2021-0004 Singeltary Submission



Docket No. APHIS-2018-0011 Chronic Wasting Disease Herd Certification



5 or 6 years quarantine is NOT LONG ENOUGH FOR CWD TSE PRION !!!

QUARANTINE NEEDS TO BE 21 YEARS FOR CWD TSE PRION !

FRIDAY, APRIL 30, 2021 

Should Property Evaluations Contain Scrapie, CWD, TSE PRION Environmental Contamination of the land?

***> Confidential!!!!

***> As early as 1992-3 there had been long studies conducted on small pastures containing scrapie infected sheep at the sheep research station associated with the Neuropathogenesis Unit in Edinburgh, Scotland. Whether these are documented...I don't know. But personal recounts both heard and recorded in a daily journal indicate that leaving the pastures free and replacing the topsoil completely at least 2 feet of thickness each year for SEVEN years....and then when very clean (proven scrapie free) sheep were placed on these small pastures.... the new sheep also broke out with scrapie and passed it to offspring. I am not sure that TSE contaminated ground could ever be free of the agent!! A very frightening revelation!!!

---end personal email---end...tss


WEDNESDAY, DECEMBER 04, 2013 

Chronic Wasting Disease CWD and Land Value concerns? 


***> This is very likely to have parallels with control efforts for CWD in cervids. <***

Paper

Rapid recontamination of a farm building occurs after attempted prion removal

Kevin Christopher Gough BSc (Hons), PhD Claire Alison Baker BSc (Hons) Steve Hawkins MIBiol Hugh Simmons BVSc, MRCVS, MBA, MA Timm Konold DrMedVet, PhD, MRCVS … See all authors 

First published: 19 January 2019 https://doi.org/10.1136/vr.105054

Abstract

The transmissible spongiform encephalopathy scrapie of sheep/goats and chronic wasting disease of cervids are associated with environmental reservoirs of infectivity. Preventing environmental prions acting as a source of infectivity to healthy animals is of major concern to farms that have had outbreaks of scrapie and also to the health management of wild and farmed cervids. Here, an efficient scrapie decontamination protocol was applied to a farm with high levels of environmental contamination with the scrapie agent. Post‐decontamination, no prion material was detected within samples taken from the farm buildings as determined using a sensitive in vitro replication assay (sPMCA). A bioassay consisting of 25 newborn lambs of highly susceptible prion protein genotype VRQ/VRQ introduced into this decontaminated barn was carried out in addition to sampling and analysis of dust samples that were collected during the bioassay. Twenty‐four of the animals examined by immunohistochemical analysis of lymphatic tissues were scrapie‐positive during the bioassay, samples of dust collected within the barn were positive by month 3. The data illustrates the difficulty in decontaminating farm buildings from scrapie, and demonstrates the likely contribution of farm dust to the recontamination of these environments to levels that are capable of causing disease.

snip...

This study clearly demonstrates the difficulty in removing scrapie infectivity from the farm environment. Practical and effective prion decontamination methods are still urgently required for decontamination of scrapie infectivity from farms that have had cases of scrapie and this is particularly relevant for scrapiepositive goatherds, which currently have limited genetic resistance to scrapie within commercial breeds.24 This is very likely to have parallels with control efforts for CWD in cervids.


***>This is very likely to have parallels with control efforts for CWD in cervids.







***> Infectious agent of sheep scrapie may persist in the environment for at least 16 years

***> Nine of these recurrences occurred 14–21 years after culling, apparently as the result of environmental contamination, but outside entry could not always be absolutely excluded. 

JOURNAL OF GENERAL VIROLOGY Volume 87, Issue 12

Infectious agent of sheep scrapie may persist in the environment for at least 16 years Free

Gudmundur Georgsson1, Sigurdur Sigurdarson2, Paul Brown3


Saturday, January 5, 2019 

Rapid recontamination of a farm building occurs after attempted prion removal 


The effectiveness of on-farm decontamination methods for scrapie - SE1865

Description

Scrapie infectivity persists on farms where infected animals have been removed1. Recently we have demonstrated that it is possible to detect environmental scrapie contamination biochemically using serial Protein Misfolding Cyclic Amplification (sPMCA)2, allowing the monitoring of scrapie infectivity on farm premises. Ongoing Defra study SE1863 has compared pen decontamination regimes on a scrapie-infected farm by both sheep bioassay and sPMCA. For bioassay, scrapie-free genetically susceptible lambs were introduced into pens decontaminated using distinct methodologies, all pens contained scrapie-positive lambs within 1 year. Remarkably this included lambs housed within a pen which had been jet washed/chloros treated, followed by regalvanisation/ replacement of all metalwork and painting of all other surfaces.

We have recently demonstrated using sPMCA, that material collected on swabs from vertical surfaces at heights inaccessible to sheep within a barn on the same scrapie affected farm contained scrapie prions (unpublished observations). We hypothesise that scrapie prions are most likely to have been deposited in these areas by bioaerosol movement. We propose that this bioaerosol movement contributes to scrapie transmission within the barn, and could account for the sheep that became positive within the pen containing re-galvanised/new metalwork and repainted surfaces (project SE1863). It is proposed that a thorough decontamination that would minimise prion-contaminated dust, both within the building and its immediate vicinity, is likely to increase the effectiveness of current methods for decontaminating farm buildings following outbreaks of scrapie. The proposed study builds on our previous data and will thoroughly investigate the potential for farm building scrapie-contamination via the bioaerosol route, a previously unrecognised route for dissemination of scrapie infectivity. This route could lead to the direct infection of healthy animals and/or indirect transmission of disease via contamination of surfaces within animal pens. The proposed study would analyse material collected using air samplers set up within “scrapie-infected” barns and their immediate vicinity, to confirm that prion containing material can be airborne within a scrapie infected farm environment. The study would incorporate a biochemical assessment of different surface decontamination methods, in order to demonstrate the best methodology and then the analysis of air and surface samples after a complete building decontamination to remove sources of dust and surface bound prions from both the building and its immediate vicinity. Analysis of such surface and air samples collected before and after treatment would measure the reduction in levels of infectivity. It is envisaged that the biochemical demonstration of airborne prions and the effective reduction in such prion dissemination would lead to a sheep bioassay experiment that would be conducted after a full farm decontamination. This would fully assess the effectiveness of an optimised scrapie decontamination strategy.

This study will contribute directly to Defra policy on best practice for on-farm decontamination after outbreaks of scrapie; a situation particularly relevant to decontamination after scrapie cases on goat farms where no genetic resistance to scrapie has currently been identified, and where complete decontamination is essential in order to stop recurrence of scrapie after restocking.

Objective

Phase 1

• Determine the presence and relative levels of airborne prions on a scrapie infected farm.

• Evaluate different pen surface decontamination procedures.

Phase 2

• Determine the presence of any airborne prions in a barn after a full decontamination.

Phase 3

• Further assess the efficacy of the decontamination procedure investigated in phase 2 by sheep bioassay.

Time-Scale and Cost

From: 2012 

To: 2016 

Cost: £326,784

Contractor / Funded Organisations

A D A S UK Ltd (ADAS)

Keywords Animals Fields of Study Animal Health


The Effectiveness of on-Farm Decontamination Methods for Scrapie

Institutions ADAS

Start date 2012

End date 2016

Objective Phase 1

Determine the presence and relative levels of airborne prions on a scrapie infected farm. Evaluate different pen surface decontamination procedures.

Phase 2

Determine the presence of any airborne prions in a barn after a full decontamination.

Phase 3

Further assess the efficacy of the decontamination procedure investigated in phase 2 by sheep bioassay.

More information

Scrapie infectivity persists on farms where infected animals have been removed1. Recently we have demonstrated that it is possible to detect environmental scrapie contamination biochemically using serial Protein Misfolding Cyclic Amplification (sPMCA)2, allowing the monitoring of scrapie infectivity on farm premises. Ongoing Defra study SE1863 has compared pen decontamination regimes on a scrapie-infected farm by both sheep bioassay and sPMCA. For bioassay, scrapie-free genetically susceptible lambs were introduced into pens decontaminated using distinct methodologies, all pens contained scrapie-positive lambs within 1 year. Remarkably this included lambs housed within a pen which had been jet washed/chloros treated, followed by regalvanisation/replacement of all metalwork and painting of all other surfaces.

We have recently demonstrated using sPMCA, that material collected on swabs from vertical surfaces at heights inaccessible to sheep within a barn on the same scrapie affected farm contained scrapie prions (unpublished observations). We hypothesise that scrapie prions are most likely to have been deposited in these areas by bioaerosol movement. We propose that this bioaerosol movement contributes to scrapie transmission within the barn, and could account for the sheep that became positive within the pen containing re-galvanised/new metalwork and repainted surfaces (project SE1863). It is proposed that a thorough decontamination that would minimise prion-contaminated dust, both within the building and its immediate vicinity, is likely to increase the effectiveness of current methods for decontaminating farm buildings following outbreaks of scrapie. The proposed study builds on our previous data and will thoroughly investigate the potential for farm building scrapie contamination via the bioaerosol route, a previously unrecognised route for dissemination of scrapie infectivity. This route could lead to the direct infection of healthy animals and/or indirect transmission of disease via contamination of surfaces within animal pens. The proposed study would analyse material collected using air samplers set up within “scrapie-infected” barns and their immediate vicinity, to confirm that prion containing material can be airborne within a scrapie infected farm environment. The study would incorporate a biochemical assessment of different surface decontamination methods, in order to demonstrate the best methodology and then the analysis of air and surface samples after a complete building decontamination to remove sources of dust and surface bound prions from both the building and its immediate vicinity. Analysis of such surface and air samples collected before and after treatment would measure the reduction in levels of infectivity. It is envisaged that the biochemical demonstration of airborne prions and the effective reduction in such prion dissemination would lead to a sheep bioassay experiment that would be conducted after a full farm decontamination. This would fully assess the effectiveness of an optimised scrapie decontamination strategy.

This study will contribute directly to Defra policy on best practice for on-farm decontamination after outbreaks of scrapie; a situation particularly relevant to decontamination after scrapie cases on goat farms where no genetic resistance to scrapie has currently been identified, and where complete decontamination is essential in order to stop recurrence of scrapie after restocking.

Funding Source

Department for Environment, Food and Rural Affairs

Project source

View this project

Project number

SE1865

Categories

Foodborne Disease

Policy and Planning 


Circulation of prions within dust on a scrapie affected farm

Kevin C Gough1 , Claire A Baker2 , Hugh A Simmons3 , Steve A Hawkins3 and Ben C Maddison2*

Abstract

Prion diseases are fatal neurological disorders that affect humans and animals. Scrapie of sheep/goats and Chronic Wasting Disease (CWD) of deer/elk are contagious prion diseases where environmental reservoirs have a direct link to the transmission of disease. Using protein misfolding cyclic amplification we demonstrate that scrapie PrPSc can be detected within circulating dusts that are present on a farm that is naturally contaminated with sheep scrapie. The presence of infectious scrapie within airborne dusts may represent a possible route of infection and illustrates the difficulties that may be associated with the effective decontamination of such scrapie affected premises.

snip... 

Discussion We present biochemical data illustrating the airborne movement of scrapie containing material within a contaminated farm environment. We were able to detect scrapie PrPSc within extracts from dusts collected over a 70 day period, in the absence of any sheep activity. We were also able to detect scrapie PrPSc within dusts collected within pasture at 30 m but not at 60 m distance away from the scrapie contaminated buildings, suggesting that the chance of contamination of pasture by scrapie contaminated dusts decreases with distance from contaminated farm buildings. PrPSc amplification by sPMCA has been shown to correlate with infectivity and amplified products have been shown to be infectious [14,15]. These experiments illustrate the potential for low dose scrapie infectivity to be present within such samples. We estimate low ng levels of scrapie positive brain equivalent were deposited per m2 over 70 days, in a barn previously occupied by sheep affected with scrapie. This movement of dusts and the accumulation of low levels of scrapie infectivity within this environment may in part explain previous observations where despite stringent pen decontamination regimens healthy lambs still became scrapie infected after apparent exposure from their environment alone [16]. The presence of sPMCA seeding activity and by inference, infectious prions within dusts, and their potential for airborne dissemination is highly novel and may have implications for the spread of scrapie within infected premises. The low level circulation and accumulation of scrapie prion containing dust material within the farm environment will likely impede the efficient decontamination of such scrapie contaminated buildings unless all possible reservoirs of dust are removed. Scrapie containing dusts could possibly infect animals during feeding and drinking, and respiratory and conjunctival routes may also be involved. It has been demonstrated that scrapie can be efficiently transmitted via the nasal route in sheep [17], as is also the case for CWD in both murine models and in white tailed deer [18-20].

The sources of dust borne prions are unknown but it seems reasonable to assume that faecal, urine, skin, parturient material and saliva-derived prions may contribute to this mobile environmental reservoir of infectivity. This work highlights a possible transmission route for scrapie within the farm environment, and this is likely to be paralleled in CWD which shows strong similarities with scrapie in terms of prion dissemination and disease transmission. The data indicate that the presence of scrapie prions in dust is likely to make the control of these diseases a considerable challenge.


Research Project: TRANSMISSION, DIFFERENTIATION, AND PATHOBIOLOGY OF TRANSMISSIBLE SPONGIFORM ENCEPHALOPATHIES Location: Virus and Prion Research

Title: Scrapie transmits to white-tailed deer by the oral route and has a molecular profile similar to chronic wasting disease

Author 

 item Greenlee, Justin item Moore, S - Orise Fellow item Smith, Jodi - Iowa State University item Kunkle, Robert item West Greenlee, M - Iowa State University Submitted to: American College of Veterinary Pathologists Meeting Publication Type: Abstract Only Publication Acceptance Date: 8/12/2015 Publication Date: N/A Citation: N/A

Interpretive Summary:

Technical Abstract: The purpose of this work was to determine susceptibility of white-tailed deer (WTD) to the agent of sheep scrapie and to compare the resultant PrPSc to that of the original inoculum and chronic wasting disease (CWD). We inoculated WTD by a natural route of exposure (concurrent oral and intranasal (IN); n=5) with a US scrapie isolate. All scrapie-inoculated deer had evidence of PrPSc accumulation. PrPSc was detected in lymphoid tissues at preclinical time points, and deer necropsied after 28 months post-inoculation had clinical signs, spongiform encephalopathy, and widespread distribution of PrPSc in neural and lymphoid tissues. Western blotting (WB) revealed PrPSc with 2 distinct molecular profiles. WB on cerebral cortex had a profile similar to the original scrapie inoculum, whereas WB of brainstem, cerebellum, or lymph nodes revealed PrPSc with a higher profile resembling CWD. Homogenates with the 2 distinct profiles from WTD with clinical scrapie were further passaged to mice expressing cervid prion protein and intranasally to sheep and WTD. In cervidized mice, the two inocula have distinct incubation times. Sheep inoculated intranasally with WTD derived scrapie developed disease, but only after inoculation with the inoculum that had a scrapie-like profile. The WTD study is ongoing, but deer in both inoculation groups are positive for PrPSc by rectal mucosal biopsy. In summary, this work demonstrates that WTD are susceptible to the agent of scrapie, two distinct molecular profiles of PrPSc are present in the tissues of affected deer, and inoculum of either profile readily passes to deer.


THE tse prion aka mad cow type disease is not your normal pathogen. 

The TSE prion disease survives ashing to 600 degrees celsius, that’s around 1112 degrees farenheit. 

you cannot cook the TSE prion disease out of meat. 

you can take the ash and mix it with saline and inject that ash into a mouse, and the mouse will go down with TSE. 

Prion Infected Meat-and-Bone Meal Is Still Infectious after Biodiesel Production as well. 

the TSE prion agent also survives Simulated Wastewater Treatment Processes. 

IN fact, you should also know that the TSE Prion agent will survive in the environment for years, if not decades. 

you can bury it and it will not go away. 

The TSE agent is capable of infected your water table i.e. Detection of protease-resistant cervid prion protein in water from a CWD-endemic area. 

it’s not your ordinary pathogen you can just cook it out and be done with. 

***> that’s what’s so worrisome about Iatrogenic mode of transmission, a simple autoclave will not kill this TSE prion agent.

1: J Neurol Neurosurg Psychiatry 1994 Jun;57(6):757-8 

***> Transmission of Creutzfeldt-Jakob disease to a chimpanzee by electrodes contaminated during neurosurgery. 

Gibbs CJ Jr, Asher DM, Kobrine A, Amyx HL, Sulima MP, Gajdusek DC. 

Laboratory of Central Nervous System Studies, National Institute of 

Neurological Disorders and Stroke, National Institutes of Health, 

Bethesda, MD 20892. 

Stereotactic multicontact electrodes used to probe the cerebral cortex of a middle aged woman with progressive dementia were previously implicated in the accidental transmission of Creutzfeldt-Jakob disease (CJD) to two younger patients. The diagnoses of CJD have been confirmed for all three cases. More than two years after their last use in humans, after three cleanings and repeated sterilisation in ethanol and formaldehyde vapour, the electrodes were implanted in the cortex of a chimpanzee. Eighteen months later the animal became ill with CJD. This finding serves to re-emphasise the potential danger posed by reuse of instruments contaminated with the agents of spongiform encephalopathies, even after scrupulous attempts to clean them. 

PMID: 8006664 [PubMed - indexed for MEDLINE] 


New studies on the heat resistance of hamster-adapted scrapie agent: Threshold survival after ashing at 600°C suggests an inorganic template of replication 


Prion Infected Meat-and-Bone Meal Is Still Infectious after Biodiesel Production 


MONDAY, APRIL 19, 2021

Evaluation of the application for new alternative biodiesel production process for rendered fat including Category 1 animal by-products (BDI-RepCat® process, AT) ???


Detection of protease-resistant cervid prion protein in water from a CWD-endemic area 


A Quantitative Assessment of the Amount of Prion Diverted to Category 1 Materials and Wastewater During Processing 


Rapid assessment of bovine spongiform encephalopathy prion inactivation by heat treatment in yellow grease produced in the industrial manufacturing process of meat and bone meals 


THURSDAY, FEBRUARY 28, 2019 

BSE infectivity survives burial for five years with only limited spread



***> CONGRESSIONAL ABSTRACTS PRION CONFERENCE 2018

P69 Experimental transmission of CWD from white-tailed deer to co-housed reindeer 

Mitchell G (1), Walther I (1), Staskevicius A (1), Soutyrine A (1), Balachandran A (1) 

(1) National & OIE Reference Laboratory for Scrapie and CWD, Canadian Food Inspection Agency, Ottawa, Ontario, Canada. 

Chronic wasting disease (CWD) continues to be detected in wild and farmed cervid populations of North America, affecting predominantly white-tailed deer, mule deer and elk. Extensive herds of wild caribou exist in northern regions of Canada, although surveillance has not detected the presence of CWD in this population. Oral experimental transmission has demonstrated that reindeer, a species closely related to caribou, are susceptible to CWD. Recently, CWD was detected for the first time in Europe, in wild Norwegian reindeer, advancing the possibility that caribou in North America could also become infected. Given the potential overlap in habitat between wild CWD-infected cervids and wild caribou herds in Canada, we sought to investigate the horizontal transmissibility of CWD from white-tailed deer to reindeer. 

Two white-tailed deer were orally inoculated with a brain homogenate prepared from a farmed Canadian white-tailed deer previously diagnosed with CWD. Two reindeer, with no history of exposure to CWD, were housed in the same enclosure as the white-tailed deer, 3.5 months after the deer were orally inoculated. The white-tailed deer developed clinical signs consistent with CWD beginning at 15.2 and 21 months post-inoculation (mpi), and were euthanized at 18.7 and 23.1 mpi, respectively. Confirmatory testing by immunohistochemistry (IHC) and western blot demonstrated widespread aggregates of pathological prion protein (PrPCWD) in the central nervous system and lymphoid tissues of both inoculated white-tailed deer. Both reindeer were subjected to recto-anal mucosal associated lymphoid tissue (RAMALT) biopsy at 20 months post-exposure (mpe) to the white-tailed deer. The biopsy from one reindeer contained PrPCWD confirmed by IHC. This reindeer displayed only subtle clinical evidence of disease prior to a rapid decline in condition requiring euthanasia at 22.5 mpe. Analysis of tissues from this reindeer by IHC revealed widespread PrPCWD deposition, predominantly in central nervous system and lymphoreticular tissues. Western blot molecular profiles were similar between both orally inoculated white-tailed deer and the CWD positive reindeer. Despite sharing the same enclosure, the other reindeer was RAMALT negative at 20 mpe, and PrPCWD was not detected in brainstem and lymphoid tissues following necropsy at 35 mpe. Sequencing of the prion protein gene from both reindeer revealed differences at several codons, which may have influenced susceptibility to infection. 

Natural transmission of CWD occurs relatively efficiently amongst cervids, supporting the expanding geographic distribution of disease and the potential for transmission to previously naive populations. The efficient horizontal transmission of CWD from white-tailed deer to reindeer observed here highlights the potential for reindeer to become infected if exposed to other cervids or environments infected with CWD. 

SOURCE REFERENCE 2018 PRION CONFERENCE ABSTRACT

Research Project: TRANSMISSION, DIFFERENTIATION, AND PATHOBIOLOGY OF TRANSMISSIBLE SPONGIFORM ENCEPHALOPATHIES Location: Virus and Prion Research

Title: Horizontal transmission of chronic wasting disease in reindeer

Author

item MOORE, SARAH - ORISE FELLOW item KUNKLE, ROBERT item WEST GREENLEE, MARY - IOWA STATE UNIVERSITY item Nicholson, Eric item RICHT, JUERGEN item HAMIR, AMIRALI item WATERS, WADE item Greenlee, Justin

Submitted to: Emerging Infectious Diseases

Publication Type: Peer Reviewed Journal

Publication Acceptance Date: 8/29/2016

Publication Date: 12/1/2016

Citation: Moore, S., Kunkle, R., Greenlee, M., Nicholson, E., Richt, J., Hamir, A., Waters, W., Greenlee, J. 2016. Horizontal transmission of chronic wasting disease in reindeer. Emerging Infectious Diseases. 22(12):2142-2145. doi:10.3201/eid2212.160635.

Interpretive Summary: Chronic wasting disease (CWD) is a fatal neurodegenerative disease that occurs in farmed and wild cervids (deer and elk) of North America and was recently diagnosed in a single free-ranging reindeer (Rangifer tarandus tarandus) in Norway. CWD is a transmissible spongiform encephalopathy (TSE) that is caused by infectious proteins called prions that are resistant to various methods of decontamination and environmental degradation. Little is known about the susceptibility of or potential for transmission amongst reindeer. In this experiment, we tested the susceptibility of reindeer to CWD from various sources (elk, mule deer, or white-tailed deer) after intracranial inoculation and tested the potential for infected reindeer to transmit to non-inoculated animals by co-housing or housing in adjacent pens. Reindeer were susceptible to CWD from elk, mule deer, or white-tailed deer sources after experimental inoculation. Most importantly, non-inoculated reindeer that were co-housed with infected reindeer or housed in pens adjacent to infected reindeer but without the potential for nose-to-nose contact also developed evidence of CWD infection. This is a major new finding that may have a great impact on the recently diagnosed case of CWD in the only remaining free-ranging reindeer population in Europe as our findings imply that horizontal transmission to other reindeer within that herd has already occurred. Further, this information will help regulatory and wildlife officials developing plans to reduce or eliminate CWD and cervid farmers that want to ensure that their herd remains CWD-free, but were previously unsure of the potential for reindeer to transmit CWD.

Technical Abstract: Chronic wasting disease (CWD) is a naturally-occurring, fatal prion disease of cervids. Reindeer (Rangifer tarandus tarandus) are susceptible to CWD following oral challenge, and CWD was recently reported in a free-ranging reindeer of Norway. Potential contact between CWD-affected cervids and Rangifer species that are free-ranging or co-housed on farms presents a potential risk of CWD transmission. The aims of this study were to 1) investigate the transmission of CWD from white-tailed deer (Odocoileus virginianus; CWDwtd), mule deer (Odocoileus hemionus; CWDmd), or elk (Cervus elaphus nelsoni; CWDelk) to reindeer via the intracranial route, and 2) to assess for direct and indirect horizontal transmission to non-inoculated sentinels. Three groups of 5 reindeer fawns were challenged intracranially with CWDwtd, CWDmd, or CWDelk. Two years after challenge of inoculated reindeer, non-inoculated negative control reindeer were introduced into the same pen as the CWDwtd inoculated reindeer (direct contact; n=4) or into a pen adjacent to the CWDmd inoculated reindeer (indirect contact; n=2). Experimentally inoculated reindeer were allowed to develop clinical disease. At death/euthanasia a complete necropsy examination was performed, including immunohistochemical testing of tissues for disease-associated CWD prion protein (PrPcwd). Intracranially challenged reindeer developed clinical disease from 21 months post-inoculation (months PI). PrPcwd was detected in 5 out of 6 sentinel reindeer although only 2 out of 6 developed clinical disease during the study period (< 57 months PI). We have shown that reindeer are susceptible to CWD from various cervid sources and can transmit CWD to naïve reindeer both directly and indirectly.


Infectivity surviving ashing to 600*C is (in my opinion) degradable but infective. based on Bown & Gajdusek, (1991), landfill and burial may be assumed to have a reduction factor of 98% (i.e. a factor of 50) over 3 years. CJD-infected brain-tissue remained infectious after storing at room-temperature for 22 months (Tateishi et al, 1988). Scrapie agent is known to remain viable after at least 30 months of desiccation (Wilson et al, 1950). and pastures that had been grazed by scrapie-infected sheep still appeared to be contaminated with scrapie agent three years after they were last occupied by sheep (Palsson, 1979).


Dr. Paul Brown Scrapie Soil Test BSE Inquiry Document


Using in vitro Prion replication for high sensitive detection of prions and prionlike proteins and for understanding mechanisms of transmission. 

Claudio Soto Mitchell Center for Alzheimer's diseases and related Brain disorders, Department of Neurology, University of Texas Medical School at Houston. 

Prion and prion-like proteins are misfolded protein aggregates with the ability to selfpropagate to spread disease between cells, organs and in some cases across individuals. I n T r a n s m i s s i b l e s p o n g i f o r m encephalopathies (TSEs), prions are mostly composed by a misfolded form of the prion protein (PrPSc), which propagates by transmitting its misfolding to the normal prion protein (PrPC). The availability of a procedure to replicate prions in the laboratory may be important to study the mechanism of prion and prion-like spreading and to develop high sensitive detection of small quantities of misfolded proteins in biological fluids, tissues and environmental samples. Protein Misfolding Cyclic Amplification (PMCA) is a simple, fast and efficient methodology to mimic prion replication in the test tube. PMCA is a platform technology that may enable amplification of any prion-like misfolded protein aggregating through a seeding/nucleation process. In TSEs, PMCA is able to detect the equivalent of one single molecule of infectious PrPSc and propagate prions that maintain high infectivity, strain properties and species specificity. Using PMCA we have been able to detect PrPSc in blood and urine of experimentally infected animals and humans affected by vCJD with high sensitivity and specificity. Recently, we have expanded the principles of PMCA to amplify amyloid-beta (Aβ) and alphasynuclein (α-syn) aggregates implicated in Alzheimer's and Parkinson's diseases, respectively. Experiments are ongoing to study the utility of this technology to detect Aβ and α-syn aggregates in samples of CSF and blood from patients affected by these diseases.

=========================

***>>> Recently, we have been using PMCA to study the role of environmental prion contamination on the horizontal spreading of TSEs. These experiments have focused on the study of the interaction of prions with plants and environmentally relevant surfaces. Our results show that plants (both leaves and roots) bind tightly to prions present in brain extracts and excreta (urine and feces) and retain even small quantities of PrPSc for long periods of time. Strikingly, ingestion of prioncontaminated leaves and roots produced disease with a 100% attack rate and an incubation period not substantially longer than feeding animals directly with scrapie brain homogenate. Furthermore, plants can uptake prions from contaminated soil and transport them to different parts of the plant tissue (stem and leaves). Similarly, prions bind tightly to a variety of environmentally relevant surfaces, including stones, wood, metals, plastic, glass, cement, etc. Prion contaminated surfaces efficiently transmit prion disease when these materials were directly injected into the brain of animals and strikingly when the contaminated surfaces were just placed in the animal cage. These findings demonstrate that environmental materials can efficiently bind infectious prions and act as carriers of infectivity, suggesting that they may play an important role in the horizontal transmission of the disease.

========================

Since its invention 13 years ago, PMCA has helped to answer fundamental questions of prion propagation and has broad applications in research areas including the food industry, blood bank safety and human and veterinary disease diagnosis. 

source reference Prion Conference 2015 abstract book

Grass Plants Bind, Retain, Uptake, and Transport Infectious Prions

Sandra Pritzkow,1 Rodrigo Morales,1 Fabio Moda,1,3 Uffaf Khan,1 Glenn C. Telling,2 Edward Hoover,2 and Claudio Soto1, * 1Mitchell Center for Alzheimer’s Disease and Related Brain Disorders, Department of Neurology, University of Texas Medical School at Houston, 6431 Fannin Street, Houston, TX 77030, USA

2Prion Research Center, Department of Microbiology, Immunology, and Pathology, College of Veterinary Medicine and Biomedical Sciences, Colorado State University, Fort Collins, CO 80523, USA

3Present address: IRCCS Foundation Carlo Besta Neurological Institute, 20133 Milan, Italy *Correspondence: claudio.soto@uth.tmc.edu http://dx.doi.org/10.1016/j.celrep.2015.04.036

SUMMARY

Prions are the protein-based infectious agents responsible for prion diseases. Environmental prion contamination has been implicated in disease transmission. Here, we analyzed the binding and retention of infectious prion protein (PrPSc) to plants. Small quantities of PrPSc contained in diluted brain homogenate or in excretory materials (urine and feces) can bind to wheat grass roots and leaves. Wild-type hamsters were efficiently infected by ingestion of prion-contaminated plants. The prion-plant interaction occurs with prions from diverse origins, including chronic wasting disease. Furthermore, leaves contaminated by spraying with a prion-containing preparation retained PrPSc for several weeks in the living plant. Finally, plants can uptake prions from contaminated soil and transport them to aerial parts of the plant (stem and leaves). These findings demonstrate that plants can efficiently bind infectious prions and act as carriers of infectivity, suggesting a possible role of environmental prion contamination in the horizontal transmission of the disease.

INTRODUCTION

snip...

DISCUSSION

This study shows that plants can efficiently bind prions contained in brain extracts from diverse prion infected animals, including CWD-affected cervids. PrPSc attached to leaves and roots from wheat grass plants remains capable of seeding prion replication in vitro. Surprisingly, the small quantity of PrPSc naturally excreted in urine and feces from sick hamster or cervids was enough to efficiently contaminate plant tissue. Indeed, our results suggest that the majority of excreted PrPSc is efficiently captured by plants’ leaves and roots. Moreover, leaves can be contaminated by spraying them with a prion-containing extract, and PrPSc remains detectable in living plants for as long as the study was performed (several weeks). Remarkably, prion contaminated plants transmit prion disease to animals upon ingestion, producing a 100% attack rate and incubation periods not substantially longer than direct oral administration of sick brain homogenates.

Finally, an unexpected but exciting result was that plants were able to uptake prions from contaminated soil and transport them to aerial parts of the plant tissue. Although it may seem farfetched that plants can uptake proteins from the soil and transport it to the parts above the ground, there are already published reports of this phenomenon (McLaren et al., 1960; Jensen and McLaren, 1960;Paungfoo-Lonhienne et al., 2008). The high resistance of prions to degradation and their ability to efficiently cross biological barriers may play a role in this process. The mechanism by which plants bind, retain, uptake, and transport prions is unknown. We are currently studying the way in which prions interact with plants using purified, radioactively labeled PrPSc to determine specificity of the interaction, association constant, reversibility, saturation, movement, etc.

Epidemiological studies have shown numerous instances of scrapie or CWD recurrence upon reintroduction of animals on pastures previously exposed to prion-infected animals. Indeed, reappearance of scrapie has been documented following fallow periods of up to 16 years (Georgsson et al., 2006), and pastures were shown to retain infectious CWD prions for at least 2 years after exposure (Miller et al., 2004). It is likely that the environmentally mediated transmission of prion diseases depends upon the interaction of prions with diverse elements, including soil, water, environmental surfaces, various invertebrate animals, and plants.

However, since plants are such an important component of the environment and also a major source of food for many animal species, including humans, our results may have far-reaching implications for animal and human health. Currently, the perception of the riskfor animal-to-human prion transmission has beenmostly limited to consumption or exposure to contaminated meat; our results indicate that plants might also be an important vector of transmission that needs to be considered in risk assessment. 


RIGINAL RESEARCH ARTICLE

Front. Vet. Sci., 14 September 2015 | https://doi.org/10.3389/fvets.2015.00032

Objects in contact with classical scrapie sheep act as a reservoir for scrapie transmission

imageTimm Konold1*, imageStephen A. C. Hawkins2, imageLisa C. Thurston3, imageBen C. Maddison4, imageKevin C. Gough5, imageAnthony Duarte1 and imageHugh A. Simmons1

1Animal Sciences Unit, Animal and Plant Health Agency Weybridge, Addlestone, UK

2Pathology Department, Animal and Plant Health Agency Weybridge, Addlestone, UK

3Surveillance and Laboratory Services, Animal and Plant Health Agency Penrith, Penrith, UK

4ADAS UK, School of Veterinary Medicine and Science, University of Nottingham, Sutton Bonington, UK

5School of Veterinary Medicine and Science, University of Nottingham, Sutton Bonington, UK

Classical scrapie is an environmentally transmissible prion disease of sheep and goats. Prions can persist and remain potentially infectious in the environment for many years and thus pose a risk of infecting animals after re-stocking. In vitro studies using serial protein misfolding cyclic amplification (sPMCA) have suggested that objects on a scrapie-affected sheep farm could contribute to disease transmission. This in vivo study aimed to determine the role of field furniture (water troughs, feeding troughs, fencing, and other objects that sheep may rub against) used by a scrapie-infected sheep flock as a vector for disease transmission to scrapie-free lambs with the prion protein genotype VRQ/VRQ, which is associated with high susceptibility to classical scrapie. When the field furniture was placed in clean accommodation, sheep became infected when exposed to either a water trough (four out of five) or to objects used for rubbing (four out of seven). This field furniture had been used by the scrapie-infected flock 8 weeks earlier and had previously been shown to harbor scrapie prions by sPMCA. Sheep also became infected (20 out of 23) through exposure to contaminated field furniture placed within pasture not used by scrapie-infected sheep for 40 months, even though swabs from this furniture tested negative by PMCA. This infection rate decreased (1 out of 12) on the same paddock after replacement with clean field furniture. Twelve grazing sheep exposed to field furniture not in contact with scrapie-infected sheep for 18 months remained scrapie free. The findings of this study highlight the role of field furniture used by scrapie-infected sheep to act as a reservoir for disease re-introduction although infectivity declines considerably if the field furniture has not been in contact with scrapie-infected sheep for several months. PMCA may not be as sensitive as VRQ/VRQ sheep to test for environmental contamination.

snip...

Discussion 

Classical scrapie is an environmentally transmissible disease because it has been reported in naïve, supposedly previously unexposed sheep placed in pastures formerly occupied by scrapie-infected sheep (4, 19, 20). 

Although the vector for disease transmission is not known, soil is likely to be an important reservoir for prions (2) where – based on studies in rodents – prions can adhere to minerals as a biologically active form (21) and remain infectious for more than 2 years (22). 

Similarly, chronic wasting disease (CWD) has re-occurred in mule deer housed in paddocks used by infected deer 2 years earlier, which was assumed to be through foraging and soil consumption (23). 

Our study suggested that the risk of acquiring scrapie infection was greater through exposure to contaminated wooden, plastic, and metal surfaces via water or food troughs, fencing, and hurdles than through grazing. 

Drinking from a water trough used by the scrapie flock was sufficient to cause infection in sheep in a clean building. 

Exposure to fences and other objects used for rubbing also led to infection, which supported the hypothesis that skin may be a vector for disease transmission (9). 

The risk of these objects to cause infection was further demonstrated when 87% of 23 sheep presented with PrPSc in lymphoid tissue after grazing on one of the paddocks, which contained metal hurdles, a metal lamb creep and a water trough in contact with the scrapie flock up to 8 weeks earlier, whereas no infection had been demonstrated previously in sheep grazing on this paddock, when equipped with new fencing and field furniture. 

When the contaminated furniture and fencing were removed, the infection rate dropped significantly to 8% of 12 sheep, with soil of the paddock as the most likely source of infection caused by shedding of prions from the scrapie-infected sheep in this paddock up to a week earlier. 

This study also indicated that the level of contamination of field furniture sufficient to cause infection was dependent on two factors: stage of incubation period and time of last use by scrapie-infected sheep. 

Drinking from a water trough that had been used by scrapie sheep in the predominantly pre-clinical phase did not appear to cause infection, whereas infection was shown in sheep drinking from the water trough used by scrapie sheep in the later stage of the disease. 

It is possible that contamination occurred through shedding of prions in saliva, which may have contaminated the surface of the water trough and subsequently the water when it was refilled. 

Contamination appeared to be sufficient to cause infection only if the trough was in contact with sheep that included clinical cases. 

Indeed, there is an increased risk of bodily fluid infectivity with disease progression in scrapie (24) and CWD (25) based on PrPSc detection by sPMCA. 

Although ultraviolet light and heat under natural conditions do not inactivate prions (26), furniture in contact with the scrapie flock, which was assumed to be sufficiently contaminated to cause infection, did not act as vector for disease if not used for 18 months, which suggest that the weathering process alone was sufficient to inactivate prions. 

PrPSc detection by sPMCA is increasingly used as a surrogate for infectivity measurements by bioassay in sheep or mice. 

In this reported study, however, the levels of PrPSc present in the environment were below the limit of detection of the sPMCA method, yet were still sufficient to cause infection of in-contact animals. 

In the present study, the outdoor objects were removed from the infected flock 8 weeks prior to sampling and were positive by sPMCA at very low levels (2 out of 37 reactions). 

As this sPMCA assay also yielded 2 positive reactions out of 139 in samples from the scrapie-free farm, the sPMCA assay could not detect PrPSc on any of the objects above the background of the assay. 

False positive reactions with sPMCA at a low frequency associated with de novo formation of infectious prions have been reported (27, 28). 

This is in contrast to our previous study where we demonstrated that outdoor objects that had been in contact with the scrapie-infected flock up to 20 days prior to sampling harbored PrPSc that was detectable by sPMCA analysis [4 out of 15 reactions (12)] and was significantly more positive by the assay compared to analogous samples from the scrapie-free farm. 

This discrepancy could be due to the use of a different sPMCA substrate between the studies that may alter the efficiency of amplification of the environmental PrPSc. 

In addition, the present study had a longer timeframe between the objects being in contact with the infected flock and sampling, which may affect the levels of extractable PrPSc. 

Alternatively, there may be potentially patchy contamination of this furniture with PrPSc, which may have been missed by swabbing. 

The failure of sPMCA to detect CWD-associated PrP in saliva from clinically affected deer despite confirmation of infectivity in saliva-inoculated transgenic mice was associated with as yet unidentified inhibitors in saliva (29), and it is possible that the sensitivity of sPMCA is affected by other substances in the tested material. 

In addition, sampling of amplifiable PrPSc and subsequent detection by sPMCA may be more difficult from furniture exposed to weather, which is supported by the observation that PrPSc was detected by sPMCA more frequently in indoor than outdoor furniture (12). 

A recent experimental study has demonstrated that repeated cycles of drying and wetting of prion-contaminated soil, equivalent to what is expected under natural weathering conditions, could reduce PMCA amplification efficiency and extend the incubation period in hamsters inoculated with soil samples (30). 

This seems to apply also to this study even though the reduction in infectivity was more dramatic in the sPMCA assays than in the sheep model. 

Sheep were not kept until clinical end-point, which would have enabled us to compare incubation periods, but the lack of infection in sheep exposed to furniture that had not been in contact with scrapie sheep for a longer time period supports the hypothesis that prion degradation and subsequent loss of infectivity occurs even under natural conditions. 

In conclusion, the results in the current study indicate that removal of furniture that had been in contact with scrapie-infected animals should be recommended, particularly since cleaning and decontamination may not effectively remove scrapie infectivity (31), even though infectivity declines considerably if the pasture and the field furniture have not been in contact with scrapie-infected sheep for several months. As sPMCA failed to detect PrPSc in furniture that was subjected to weathering, even though exposure led to infection in sheep, this method may not always be reliable in predicting the risk of scrapie infection through environmental contamination. 

These results suggest that the VRQ/VRQ sheep model may be more sensitive than sPMCA for the detection of environmentally associated scrapie, and suggest that extremely low levels of scrapie contamination are able to cause infection in susceptible sheep genotypes. 

Keywords: classical scrapie, prion, transmissible spongiform encephalopathy, sheep, field furniture, reservoir, serial protein misfolding cyclic amplification 


2020

Monday, November 30, 2020 

Tunisia has become the second country after Algeria to detect a case of CPD Camel Prion Disease within a year 

REPORT OF THE MEETING OF THE OIE SCIENTIFIC COMMISSION FOR ANIMAL DISEASES Paris, 9–13 September 2019

Scientific Commission/September 2019

Tunisia has become the second country after Algeria to detect a case of CPD within a year

10.2. Prion disease in dromedary camels 


CWD AND SCRAPIE TRANSMIT TO PIGS BY ORAL ROUTES

Research Project: TRANSMISSION, DIFFERENTIATION, AND PATHOBIOLOGY OF TRANSMISSIBLE SPONGIFORM ENCEPHALOPATHIES Location: Virus and Prion Research

Title: Disease-associated prion protein detected in lymphoid tissues from pigs challenged with the agent of chronic wasting disease 

Conclusions: This study demonstrates that PrPSc accumulates in lymphoid tissues from pigs challenged intracranially or orally with the CWD agent, and can be detected as early as 4 months after challenge. CWD-infected pigs rarely develop clinical disease and if they do, they do so after a long incubation period. This raises the possibility that CWD-infected pigs could shed prions into their environment long before they develop clinical disease. Furthermore, lymphoid tissues from CWD-infected pigs could present a potential source of CWD infectivity in the animal and human food chains.



Research Project: Pathobiology, Genetics, and Detection of Transmissible Spongiform Encephalopathies Location: Virus and Prion Research

Title: The agent of chronic wasting disease from pigs is infectious in transgenic mice expressing human PRNP 

Author item MOORE, S - Orise Fellow item Kokemuller, Robyn item WEST-GREENLEE, M - Iowa State University item BALKEMA-BUSCHMANN, ANNE - Friedrich-Loeffler-institut item GROSCHUP, MARTIN - Friedrich-Loeffler-institut item Greenlee, Justin Submitted to: Prion Publication Type: Abstract Only Publication Acceptance Date: 5/10/2018 Publication Date: 5/22/2018 Citation: Moore, S.J., Kokemuller, R.D., West-Greenlee, M.H., Balkema-Buschmann, A., Groschup, M.H., Greenlee, J.J. 2018. The agent of chronic wasting disease from pigs is infectious in transgenic mice expressing human PRNP. Prion 2018, Santiago de Compostela, Spain, May 22-25, 2018. Paper No. WA15, page 44.

Interpretive Summary:

 The successful transmission of pig-passaged CWD to Tg40 mice reported here suggests that passage of the CWD agent through pigs results in a change of the transmission characteristics which reduces the transmission barrier of Tg40 mice to the CWD agent. If this biological behavior is recapitulated in the original host species, passage of the CWD agent through pigs could potentially lead to increased pathogenicity of the CWD agent in humans.


cwd scrapie pigs oral routes 

***> However, at 51 months of incubation or greater, 5 animals were positive by one or more diagnostic methods. Furthermore, positive bioassay results were obtained from all inoculated groups (oral and intracranial; market weight and end of study) suggesting that swine are potential hosts for the agent of scrapie. <*** 

>*** Although the current U.S. feed ban is based on keeping tissues from TSE infected cattle from contaminating animal feed, swine rations in the U.S. could contain animal derived components including materials from scrapie infected sheep and goats. These results indicating the susceptibility of pigs to sheep scrapie, coupled with the limitations of the current feed ban, indicates that a revision of the feed ban may be necessary to protect swine production and potentially human health. <*** 

***> Results: PrPSc was not detected by EIA and IHC in any RPLNs. All tonsils and MLNs were negative by IHC, though the MLN from one pig in the oral <6 month group was positive by EIA. PrPSc was detected by QuIC in at least one of the lymphoid tissues examined in 5/6 pigs in the intracranial <6 months group, 6/7 intracranial >6 months group, 5/6 pigs in the oral <6 months group, and 4/6 oral >6 months group. Overall, the MLN was positive in 14/19 (74%) of samples examined, the RPLN in 8/18 (44%), and the tonsil in 10/25 (40%). 

***> Conclusions: This study demonstrates that PrPSc accumulates in lymphoid tissues from pigs challenged intracranially or orally with the CWD agent, and can be detected as early as 4 months after challenge. CWD-infected pigs rarely develop clinical disease and if they do, they do so after a long incubation period. This raises the possibility that CWD-infected pigs could shed prions into their environment long before they develop clinical disease. Furthermore, lymphoid tissues from CWD-infected pigs could present a potential source of CWD infectivity in the animal and human food chains. 




Conclusions: This study demonstrates that PrPSc accumulates in lymphoid tissues from pigs challenged intracranially or orally with the CWD agent, and can be detected as early as 4 months after challenge. CWD-infected pigs rarely develop clinical disease and if they do, they do so after a long incubation period. This raises the possibility that CWD-infected pigs could shed prions into their environment long before they develop clinical disease. Furthermore, lymphoid tissues from CWD-infected pigs could present a potential source of CWD infectivity in the animal and human food chains.


CONFIDENTIAL

EXPERIMENTAL PORCINE SPONGIFORM ENCEPHALOPATHY

LINE TO TAKE

3. If questions on pharmaceuticals are raised at the Press conference, the suggested line to take is as follows:- 

 "There are no medicinal products licensed for use on the market which make use of UK-derived porcine tissues with which any hypothetical “high risk" ‘might be associated. The results of the recent experimental work at the CSM will be carefully examined by the CSM‘s Working Group on spongiform encephalopathy at its next meeting.

DO Hagger RM 1533 MT Ext 3201


While this clearly is a cause for concern we should not jump to the conclusion that this means that pigs will necessarily be infected by bone and meat meal fed by the oral route as is the case with cattle. ...


we cannot rule out the possibility that unrecognised subclinical spongiform encephalopathy could be present in British pigs though there is no evidence for this: only with parenteral/implantable pharmaceuticals/devices is the theoretical risk to humans of sufficient concern to consider any action.


May I, at the outset, reiterate that we should avoid dissemination of papers relating to this experimental finding to prevent premature release of the information. ...


3. It is particularly important that this information is not passed outside the Department, until Ministers have decided how they wish it to be handled. ...


But it would be easier for us if pharmaceuticals/devices are not directly mentioned at all. ...


Our records show that while some use is made of porcine materials in medicinal products, the only products which would appear to be in a hypothetically ''higher risk'' area are the adrenocorticotrophic hormone for which the source material comes from outside the United Kingdom, namely America China Sweden France and Germany. The products are manufactured by Ferring and Armour. A further product, ''Zenoderm Corium implant'' manufactured by Ethicon, makes use of porcine skin - which is not considered to be a ''high risk'' tissue, but one of its uses is described in the data sheet as ''in dural replacement''. This product is sourced from the United Kingdom.....


Sent: Fri, Aug 27, 2021 11:08 am

Subject: Chronic Wasting Disease from pigs is infectious in transgenic mice expressing human PRNP

FRIDAY, AUGUST 27, 2021 

Chronic Wasting Disease from pigs is infectious in transgenic mice expressing human PRNP



FRIDAY, AUGUST 27, 2021 

Cattle are highly susceptible to white-tailed deer CWD and mule deer CWD in experimental conditions


SUNDAY, DECEMBER 20, 2020 

Second passage of chronic wasting disease of mule deer in sheep compared to classical scrapie after intracranial inoculation


THURSDAY, DECEMBER 19, 2019 

TSE surveillance statistics exotic species and domestic cats Update December 2019


Chronic wasting disease: a cervid prion infection looming to spillover

Alicia Otero 1 2 3, Camilo Duque Velásquez 1 2, Judd Aiken 2 4, Debbie McKenzie 5 6

Affiliations expand

PMID: 34488900 DOI: 10.1186/s13567-021-00986-y




Subject: Generation of human chronic wasting disease in transgenic mice

Published: 26 September 2021

Generation of human chronic wasting disease in transgenic mice

Zerui Wang, Kefeng Qin, Manuel V. Camacho, Ignazio Cali, Jue Yuan, Pingping Shen, Justin Greenlee, Qingzhong Kong, James A. Mastrianni & Wen-Quan Zou 

Acta Neuropathologica Communications volume 9, Article number: 158 (2021) Cite this article

Abstract

Chronic wasting disease (CWD) is a cervid prion disease caused by the accumulation of an infectious misfolded conformer (PrPSc) of cellular prion protein (PrPC). It has been spreading rapidly in North America and also found in Asia and Europe. Although bovine spongiform encephalopathy (i.e. mad cow disease) is the only animal prion disease known to be zoonotic, the transmissibility of CWD to humans remains uncertain. Here we report the generation of the first CWD-derived infectious human PrPSc by elk CWD PrPSc-seeded conversion of PrPC in normal human brain homogenates using in vitro protein misfolding cyclic amplification (PMCA). Western blotting with human PrP selective antibody confirmed that the PMCA-generated protease-resistant PrPSc was derived from the human PrPC substrate. Two lines of humanized transgenic mice expressing human PrP with either Val or Met at the polymorphic codon 129 developed clinical prion disease following intracerebral inoculation with the PMCA-generated CWD-derived human PrPSc. Diseased mice exhibited distinct PrPSc patterns and neuropathological changes in the brain. Our study, using PMCA and animal bioassays, provides the first evidence that CWD PrPSc can cross the species barrier to convert human PrPC into infectious PrPSc that can produce bona fide prion disease when inoculated into humanized transgenic mice.

Introduction

Prion diseases are fatal transmissible spongiform encephalopathies of humans and animals characterized by the accumulation of the infectious prion protein (PrPSc) that is derived from its cellular isoform (PrPC) through a structural transition [32]. It is known that prion diseases are less transmissible across species because of species barrier associated largely with differences in each host’s PrP sequences [31]. However, bovine spongiform encephalopathy (BSE, commonly named mad cow disease) has been well-documented to cause variant Creutzfeldt-Jakob disease (vCJD) in humans [8, 13, 41], the first proven zoonotic prion disease. The outbreak of mad cow disease and its zoonotic transmissibility raise concerns about the potential public health threat from other animal-derived prion diseases.

Chronic wasting disease (CWD) is the most contagious of all prion diseases, and it is endemic in North America, having spread to 26 US states and 3 Canadian provinces. The disease has also been found in South Korea and most recently in Europe [6, 38]. The CWD prevalence rates among free-ranging cervids are as high as 40% in some areas of Colorado, Wyoming, and Wisconsin of the United States, where large amounts of venison are consumed [21, 30, 36]. Moreover, prions are readily shed from infected cervids through urine, feces, saliva, and carcasses. Prions in these excreta and bodies remain stable and infectious in the environment for many years. Thus, CWD poses potential risks to public health in North America. However, the zoonotic potential of CWD remains uncertain. On the one hand, there has been no published epidemiological evidence to support CWD transmissibility to humans. Published transmission studies so far have consistently failed to transmit the CWD agent to “humanized” transgenic (Tg) mice expressing human PrP [20, 23, 37]. Moreover, Race and co-workers have reported that the non-human primate Cynomolgus macaques were not susceptible to CWD [33,34,35]. On the other hand, Barria and co-workers observed that human PrPC from normal humanized transgenic (Tg) mouse brains could be converted by CWD PrPSc into proteinase K (PK)-resistant PrP (PrPres), albeit at low to moderate conversion efficiencies [3, 4]. In addition, squirrel monkeys have been found to be highly susceptible to CWD from white-tailed deer, mule deer, and elk after either intracerebral or oral challenges [3, 4, 27]. Furthermore, a recent international study observed an atypical phenotype in Cynomolgus macaques after challenge with CWD prions orally or intracerebrally: the affected animals showed minimal PrPSc in the CNS by immunohistochemistry staining and positive prion seeding activity by RT-QuIC and PMCA assays [14]. These conflicting experimental data and observations preclude a clear answer on whether CWD prions are zoonotic at this point. In order to demonstrate that CWD prions are zoonotic, it will be critical to search for direct evidence that CWD prions are capable of converting human brain PrPC into infectious PrPSc, that CWD prions can infect Tg mice expressing human PrP, and that ultimately the first cases of CWD transmissions to humans are identified. In addition, generation of experimental human CWD prions will also provide critical clues for the detection and diagnosis of acquired human CWD cases if and when they occur.

It is worth noting that the annual number of sporadic CJD (sCJD) cases in the USA has increased, with the total number of suspected and confirmed sCJD cases rising from 284 in 2003 to 511 in 2017 (https://www.cdc.gov/prions/cjd/occurrence-transmission.html). The greatly enhanced CJD surveillance and an aging population in the USA certainly contributed to the observed increase in annual sCJD case numbers in recent years, but the possibility cannot be excluded that some of the increased sCJD prevalence is linked to CWD exposure.

In the present study, using serial protein misfolding cyclic amplification (sPMCA) assay we generate PrPSc by seeding CWD prions in normal human brain homogenates. Importantly, we reveal that two lines of humanized Tg mice expressing human PrP-129VV and 129MM develop prion diseases upon intracerebral inoculation of the abnormal PrP generated by sPMCA. We believe that our study provides the first opportunity to dissect the clinical, pathological and biochemical features of the CWD-derived human prion disease in two lines of humanized Tg mice expressing two major human PrP genotypes, respectively.

Materials and methods

Reagents and antibodies

Proteinase K (PK) was purchased from Sigma Chemical Co. (St. Louis, MO). Reagents for enhanced chemiluminescence (ECL Plus) were from GE Healthcare. Anti-PrP antibody 3F4 against human PrP residues 107–112 [18, 45] and horseradish peroxidase-conjugated sheep anti-mouse IgG were purchased from Millipore Sigma (Burlington, MA).

Preparation of brain samples

Frozen non-CJD human brain tissues with PrPC-129MM or PrPC-129VV were collected at autopsy and maintained at -80 °C until used as substrates in PMCA. Brain tissues from uninfected humanized TgMM or TgVV, cervidized TgDeer (kindly provided by Glenn Telling, Ph.D., Colorado State University), or hamsters were also used as substrates in serial PMCA as controls. The samples were rinsed with PBS three times to avoid blood contamination before homogenization. For sequencing of the functional cervid PrP genes, genomic DNA was purified from frozen cervid brain tissues using standard phenol–chloroform extraction, and the coding region from the PrP genes was amplified by PCR using DePrP223 (ACACCCTC-TTTATTTTGCAG) and DePrP224 (AGAAGATAATGAAAACAGGAAG) primers. The PCR products were cloned into pstBlue-1. Purified PCR product and multiple clones from each cervid DNA sample were subjected to sequencing by MCLAB (South San Francisco, CA, USA) using the same primers. The elk samples came from elk with different PRNP genotypes: #1, #2, #3, and #4 (CWD-negative) were PrP-132MM; #5, #6 and #7 were PrP-132ML; and #8 was PrP-132LL. The genotype of the deer CWD (dCWD) isolate #9 was not available. Elk samples #1 through #7 and deer sample #9 were from captive animals in the terminal stages of disease and originated from the western United States. Elk sample #8 was from an elk with the PrP-132LL genotype that was experimentally inoculated with brain homogenate from a farmed elk of the same genotype.

Brain tissues were homogenized with a mini-Beads Beater in conversion buffer containing 150 mM NaCl, 1% Triton X-100, 8 mM EDTA and a complete protease inhibitor in PBS without Ca2+ and Mg2+ for a 10% brain homogenate. The samples were then centrifuged at 500 g for 5 min. The supernatant (S1) was transferred to a clean tube for future use. Brain homogenates (10%, weight/volume) from elk (n = 7, #1-#3, #5-#8) and deer (n = 1, #9) with CWD or non-CWD (n = 1, #4) were prepared as PMCA seeds in 1 × lysis buffer containing [10 mM Tris–HCl, 150 mM NaCl, 0.5% Nonidet P-40 (NP-40), 0.5% deoxycholate, 5 mM ethylenediaminetetraacetic acid (EDTA), pH 7.4]. For prion-infected mouse brain tissues, 10% brain homogenates were prepared in 1 × lysis buffer and the brain homogenates were treated with designated amounts of PK prior to Western blotting probing with 3F4. To prepare the detergent-soluble (S2) and detergent-insoluble (P2) fractions, the PMCA products or 10% normal brain homogenate (substrate, in conversion buffer) were mixed with an equal volume of 2 × lysis buffer and then subjected to ultracentrifugation at 100,000 g for 1 h at 4 °C. The supernatant was transferred into a clean tube as the S2, whereas the pellet was resuspended in 1 × lysis buffer as the P2 at the volume equal to that of S2.

Protein misfolding cyclic amplification (PMCA)

The preparation of PrP seeds and substrates, as well as PMCA, were conducted as previously described [11, 40] and above. Each seed was diluted in the substrate at a ratio of 1:100 (1 µL seeds + 99 µL substrates containing 50 µg/mL heparin) into a 200 µL PCR tube with 1 PTFE beads (diameter 3/32’’) (Teflon, APT, RI). 20 µL of each mixture was taken and kept at − 20 °C as a non-PMCA control. The remaining mixture was subjected to serial PMCA (sPMCA). Each cycle was comprised of a 20 s elapse time of sonication at amplitude 85 (250 watts; Misonix S3000 sonicator) followed by an incubation period of 29 min 40 s at 37 °C. Each round of sPMCA consisted of 96 cycles. For subsequent sPMCA rounds, 10 µL sample was taken from the last cycle of the immediate preceding round and placed into 90 µL fresh normal brain substrates to start a new round of amplifications.

Prion-inoculation and monitoring of humanized transgenic mice

Two lines of humanized transgenic mice were used in this study for assessing the infectivity of the PMCA-induced CWD-derived human PrPSc. Humanized TgMM (also named Tg40h) and TgVV (also termed Tg1307, derived from Tg152) mice expressing wild-type human PrP carrying either 129 M or 129 V polymorphism without endogenous mouse PrP as previously described [20, 42] were used in this study. The PMCA product seeded by #6 CWD prion isolate was diluted into 1% human brain homogenate in 1 × PBS before inoculation. After anesthetization of Tg mice with isoflurane, 30 µL of the diluted PMCA product was injected intracerebrally into each mouse with a 26-gauge needle as described previously [20, 42]. After intracerebral inoculations, the animals were monitored at least 3 times per week for symptoms such as coarse coat, waddling gait, hunched back, tail plasticity, and bradykinesia. Within 2–3 d days after presentation of clear symptoms or at death, the brain was removed and one-half brain was frozen for Western blotting of PrPSc, and the other half was fixed in formalin for histology and immunohistochemistry analysis as described below.

Western blotting

PMCA brain samples were subjected to treatment with PK at 100 µg/mL for 70 min at 45 °C with agitation prior to Western blotting. Samples were resolved on 15% Tris–HCl Criterion pre-cast gels (Bio-Rad) for SDS-PAGE as described previously [44]. The proteins on the gels were transferred to Immobilon-P membrane polyvinylidene fluoride membrane (PVDF, Millipore) for 2 h at 350 mA. For probing of PrP, the membranes were incubated for 2 h at room temperature with anti-PrP antibody 3F4 at 1:40,000 as the primary antibody. Following incubation with horseradish peroxidase-conjugated sheep anti-mouse IgG at 1:5,000, the PrP bands were visualized on Kodak film (Millipore Sigma) by ECL Plus as described by the manufacturer (GE Healthcare). For detection of the PK-resistant PrPSc in the frozen brain tissues of infected Tg mice, 50 µg/mL of PK or designated amounts of PK were used as indicated in each experiment at 37 °C for 1 h.

Histology, immunohistochemistry and lesion profiles

Histological and immunohistochemical evaluations were carried out on sagittal brain levels at approximately 3.12 mm and 1.56 mm to the midline as previously described [9, 40]. Paraffin-embedded sections were stained with hematoxylin–eosin (H&E) or immunohistochemistry (IHC) probed with the 3F4 antibody at 1:1,500 dilution, 10% GVM and then processed with the DAB detection kit as described by the manufacturer. Lesion profiles were generated following semi-quantitative evaluation of spongiform degeneration (SD) severity, which was rated on a 0 to 3 scale on H&E-stained Sects. (0: not detectable; 1: mild, 2: moderate, and 3: severe). The eight brain regions examined included the cerebral cortex (CC), hippocampus (HI), basal ganglia (BG), thalamus (TH), dorsal (d) and ventral (v) midbrain (MB), inferior brainstem (BS.i), and cerebellum (CE).

Statistical analysis

The differences in incubation times between TgVV and TgMM mice inoculated with sPMCA-induced CWD-derived human PrPSc as well as differences in lesion severity between different mice were statistically analyzed using Student’s T-test to obtain p values for comparisons between two groups.

Results

Generation of CWD-derived human PrPSc by PMCA

To determine whether CWD prions from affected cervid animal brains can convert PrPC from the normal human brain into PrPSc, we conducted protein misfolding cyclic amplification (PMCA) assays. These PMCA assays used brain homogenates of 3 individual CWD elk (CWD prion isolates #1, #2, or #3) as the prion seeds and brain homogenates from three non-CJD subjects as the substrates, respectively. These non-CJD subjects included two cases homozygous for methionine (M) at polymorphic codon 129 of the PrP gene (PrP-129MM) termed MM#1 and MM#2, and a case homozygous for valine (V) at codon 129 (PrP-129VV) designated VV#1. After 1 round of PMCA, Western blotting showed PrPres in 2 of 3 PMCA products seeded with CWD brain homogenates elk #1 and #2, but not elk #3 or the negative control elk #4, with the VV#1 substrate but not the MM#1 or MM#2 substrates (Fig. 1a). Since we used the anti-PrP monoclonal antibody 3F4 that is specific for human PrP but not cervid PrP as shown in Additional file 1: Fig. S1, we conclude that all detected PK-resistant PrP is exclusively human PrPres instead of cervid PrPSc, excluding the possibility that the detected PK-resistant PrPres in the PMCA products could be the CWD PrPSc seeds themselves rather than newly-converted PrPres from human PrPC.

To rule out the possibility that the detected PrPres was de novo PrPres generated from the PrPC substrate itself by PMCA, we conducted serial PMCA (sPMCA) with normal brain homogenates in the absence of CWD PrPSc seeds (Additional file 1: Fig. S2). No PrPres was detected in MM#1 and VV#1 after 12 rounds of sPMCA while it was detected in MM#2 after 6 or more rounds and in VV#2 after 9 or more rounds of sPMCA (Additional file 1: Fig. S2a, c, d). TgVV mouse brain homogenates showed no de novo PrPres generation after 12 rounds while TgMM was observed to generate de novo PrPres after 3 or more rounds of sPMCA (Additional file 1: Fig. S2b, c, d). In addition, normal hamster brain homogenates showed generation of de novo PrPres after 6 or more rounds of sPMCA (Additional file 1: Fig. S1c) and no de novo PrPres was found in TgDeer brain homogenates after 4 rounds of sPMCA (Additional file 1: Fig. S2b).

Using the same PMCA approach, we further examined the convertibility of human brain PrPC-129VV (VV#2) by PrPSc from 7 CWD cases that were composed of 6 CWD elks (#1, #2, #5-#8) and 1 CWD deer (#9). The PMCA assays were performed with two sonicators (S1 and S2) for comparison and duplication. We observed that PrPSc from all but one CWD elk isolate (#8) was able to convert human brain PrPC-129VV into PrPres after one round of PMCA, as evidenced by the 3F4-detected PrPres in the PMCA products (Fig. 1b). PrPSc from the CWD deer was also able to convert human brain PrPC into PrPres but the efficiency was lower compared to that of CWD elk (Fig. 1b). Moreover, the sPMCA-generated CWD-derived human PrPSc (Cd-HuPrPres) was consistently amplified until round 7 that showed a decrease in the amplification efficiency in both CWD isolates examined (Additional file 1: Fig. S3). Taken together, the results indicate that most of CWD prion isolates examined in this study were able to convert human PrPC-129 V but not human PrPC-129 M to generate Cd-HuPrPres by PMCA in vitro, suggesting a possible polymorphism preference.

Examination of infectivity of CWD-derived human PrPSc by animal transmission assay

Next we intracerebrally inoculated the Cd-HuPrPres (from the fourth round PMCA seeded the CWD elk #6 PrPSc seeds in the PrPC substrate from the normal human brain homogenate of case VV#1) into humanized Tg mice. Two mouse lines were inoculated: one expressing wild-type human PrP-129VV (TgVV) or human PrP-129MM (TgMM, previously termed Tg40h) [20, 26]. All 15 TgVV mice inoculated intracerebrally with Cd-HuPrPres developed disease at an average of 233 ± 6 (standard error, SE) days post inoculation (dpi) (range, 195 to 282 dpi) (Fig. 2). All 9 inoculated TgMM mice developed disease at an average of 552 ± 27 dpi (range, 413 to 645 dpi), a significantly longer incubation time than that of inoculated TgVV mice (p < 0.00001) (Fig. 2). This is not unexpected since the Cd-HuPrPres was generated from the human VV#1 case and prior evidence supports that matching residue 129 between PrPSc and PrPC facilitates prion propagation [19, 26].

Brains of inoculated Tg mice were examined by western blotting and neurohistology for evidence of PrPSc deposition and spongiform degeneration. We compared the electrophoretic gel profiles of PrPres from both Tg mouse lines inoculated with Cd-HuPrPres after treatment of brain homogenates with a range of PK concentrations (0, 5, 25, 50, or 100 µg/mL). Interestingly, the gel mobility of PrPres from the two lines of infected animals was different, in that TgVV displayed type 2-like PrPres and TgMM exhibited type 1-like PrPres; however, the ratio of the diglycosylated to non-glycosylated PrPres species was significantly higher in Cd-HuPrPres-infected TgMM and TgVV mice (Fig. 3, Additional file 1: Fig. S4), when compared to their sCJD counterparts PrPres type 1 [9] [2.9 (n = 5) vs. 0.6 (n = 3), p < 0.001] and PrPres type 2 [42] [2.1 (n = 7) vs 0.1 (n = 3), p < 0.001] (Additional file 1: Fig. S4).

The major histopathological differences between the two lines of inoculated mice were the significantly more severe cortical spongiform degeneration (SD) and the presence of plaque deposits in TgVV mice, compared with TgMM mice (Fig. 4a, b). The plaques were visualized on hematoxylin–eosin stained slides and confirmed to be composed of PrP by IHC staining with anti-PrP antibody 3F4 (Fig. 4a). Notably, occasional plaques were surrounded by vacuoles (Fig. 4a and Additional file 1: Fig. S5), resembling the florid plaques of CWD-affected cervids [24]. IHC staining also revealed granular PrPSc deposits that co-distributed with SD. Unlike TgVV mice, TgMM mice were free of plaque-like deposits in the cerebral cortex (CC). Lesion profiling showed similar SD distributions in the two groups of mice, except for the sparse presence of vacuoles in the cerebral cortex and overall less severe SD in the TgMM mice (Fig. 4c). Among the diseased TgVV mice, more severe lesions were found in animals bearing plaques than in those that were free of plaques (Fig. 4d). Moreover, in comparison with mice expressing matched PrP codon 129 genotypes but inoculated with sCJD prions [9, 42], the Cd-HuPrPres-infected TgVV and TgMM mice showed distinctive histopathological features. These features included (1) the presence of plaques reminiscent of CWD-florid plaques in some Cd-HuPrPres-infected TgVV mice; (2) seemingly more severe cortical spongiosis in Cd-HuPrPres-infected TgVV mice than in sCJDVV2-infected TgVV mice [9]; (3) lack of PrP plaques in our Cd-HuPrPres-infected TgMM mice but not in sCJDVV2-infected TgMM mice [9]; and (4) quite distinct lesion profiles between Cd-HuPrPres-infected TgMM mice and sCJDMM1-infected TgMM mice [42]. These data demonstrate that Cd-HuPrPres is infectious and capable of inducing bona fide prion diseases in mice. We will term it as “Cd-HuPrPSc” from here on.

It is conceivable that the sPMCA-generated infectivity in the above experiments could have resulted from de novo generation of PK-sensitive prions produced by sPMCA from the normal human brain homogenate VV#1 substrate rather than from CWD-seeded human PrP conversion. To rule out this possibility, we determined whether sPMCA induced an increase in the level of the insoluble PrP compared to that of normal brain homogenate substrate without PMCA treatment. We found that 4 rounds of sPMCA in the absence of CWD seeds actually led to a slight decrease of insoluble PrP in the P2 fraction and no detectable PK-resistant PrPSc (Additional file 1: Fig. S6), strongly suggesting that the observed infectivity of CWD-seeded sPMCA products in humanized mice was highly unlikely to be due to de novo generation of PK-sensitive PrPSc.

Discussion

Our current study has made the following findings. First, PMCA reveals that elk or deer CWD prions are able to overcome species barrier directly converting human brain PrPC carrying 129 V but not 129 M polymorphism into PrPSc in vitro. Second, the PMCA-induced CWD-derived human PrPSc conformer (Cd-HuPrPSc) is infectious, as it induced clinical prion disease in two lines of humanized Tg mice expressing human PrP with either 129 V or 129 M. Finally, PrPSc in brains of the diseased humanized Tg mice exhibits the electrophoretic mobility similar to those of sCJDMM1 or sCJDVV2 subtype, but the PrPSc glycoform ratios and neuropathological patterns are different. Histopathologically, the Cd-HuPrPSc-infected TgVV and TgMM mice showed some distinctive features when compared to the Tg mice expressing the matched 129 genotypes but inoculated with sCJDMM1 or sCJDVV2 prions [9, 42]. Our findings raise several important issues and implications as to the potential transmissibility of CWD to humans involving effects of seeds and substrates on transmissibility as well as clinical phenotypes of human CWD and traits of CWD-derived human prion strains.

PMCA has been used not only for detection of small amounts of PrPSc in peripheral tissues and various body fluids of suspected prion-infected individuals but also for generation of new PrPSc [11, 12, 15, 39, 40], Moreover, it has been applied to explore the potential for cross-species conversion of PrPC to PrPres as a way to assess the susceptibility of human PrPC to animal prion strains including CWD prions [2, 10, 17, 22]. Using PMCA, an earlier study revealed that wild-type human PrPC-129MM from humanized Tg mice was converted into human PrPres, but only after the CWD prion isolate had been stabilized by successive passages in cervid brain homogenates [4]. Moreover, the newly-generated PrPres had unique biochemical properties with a glycoform pattern similar to CWD seeds but slower migration compared to the seeds. Subsequently, Barria et al. observed that elk CWD prions could convert PrPC from human brain, humanized Tg mouse brain and cultured mammalian cells [2]. They also observed that the efficiency of in vitro cell-free human PrP conversion by cervid CWD prions was influenced by the PrP polymorphism at residue 129 in humans and its equivalent (residue 132) in cervids [3]. However, another study observed that mule deer PrPSc was unable to convert human PrPC from humanized Tg mouse brain homogenates [23].

PMCA under properly optimized conditions has been believed to faithfully amplify prions from different species in vitro [29]. The parental prion seed strain traits have been observed to remain in the PMCA amplified prion products [11]. PMCA has become a useful approach to address fundamental questions about prion biology in vitro such as the molecular basis of the seeding activity, some aspects of species barrier and prion strain adaptation, and the role of cofactors on prion replication. It has been also used to assess the zoonotic potential of animal prion diseases such as BSE, scrapie, CWD, and atypical prion diseases. For instance, studies have confirmed that PMCA exhibits species specificity that faithfully reflects the same transmission barrier observed in animals in vivo [1, 10, 16, 28]. When BSE and scrapie were examined for their capability to convert human PrP with the three major polymorphic variants (PRNP codon 129 MM, MV and VV) expressed in the humanized transgenic mouse brain [5, 17], cattle BSE prions was able to trigger the efficient conversion of human PrP with a preference similar to that of human vCJD (MM > MV > VV) while scrapie failed to convert the human substrates [17]. These results suggest that PMCA can faithfully replicate aspects of cross-species transmission potential and might provide useful additional information concerning the molecular barrier to zoonotic transmission. Therefore, although in vitro seeded PrPSc amplification by PMCA may not mimic all aspects of in vivo conversion of brain PrPC into PrPSc, our finding of the CWD-induced conversion of human brain PrPC into PrPSc suggests the potential of transmission of CWD to humans. It may also provide a model to dissect the mechanisms or factors that may be involved in the potential conversion of human PrPC into PrPSc by the CWD prions.

The new Cd-HuPrPSc generated by seeding CWD isolates in human PrPC-129VV exhibits a PrP electrophoretic profile similar to that of the CWD PrPSc seeds that are observed to exhibit a more pronounced di-glycosylated PrP glycoform but an underrepresented unglycosylated PrP migrating at ~ 21 kDa [43]. Interestingly, it remains as the PrPSc type 1-like form when it is inoculated into the humanized TgMM mice, whereas it switches into the PrPSc type 2-like form when it is inoculated into the humanized TgVV mice. This phenomenon is consistent with the previous findings that PrPSc type 2 was only detected in Tg mice expressing human PrP-129 V inoculated with PrPSc sCJDMV2 or sCJDVV2 while only PrPSc type 1 was detected in mice homozygous or heterozygous for Met at residue 129 regardless of inoculated PrPSc types [7]. Moreover, PrPC-129MM substrates from two individual non-CJD human brain samples were not able to be converted by CWD prions in PMCA reactions, which contrasts with the observations of Barria et al. [2]. One possible explanation is that there are other co-factors or inhibitors affecting the PrP convertibility in the brain tissues of some subjects. This is consistent with the observations that although millions of people are believed to have been exposed to BSE-contaminated products in the European countries, especially in the UK, there were only about 229 vCJD cases reported worldwide as of 2015 [25]. It will be interesting to determine the convertibility of brain PrPC from more normal human subjects including all three PrP genotypes (129MM, 129VV and 129MV).

The conversion efficiency varied between CWD prion isolates. Of the eight CWD isolates tested in this study, the seeding efficiency of #5 and #2 were the highest, followed by #6 and #1, then #7, #9, and the lowest were #8 and #3. Notably, match or mismatch between residue 129 of the human PrP substrate and residue 132 of the elk PrPSc seeds has been observed to affect the conversion efficiency in PMCA [3]. It will be important to further characterize the effect of different polymorphisms in CWD prion seeds and human PrPC substrates on the conversion efficiency. Except for the difference in conversion efficiency, no other significant differences were detected in the electrophoretic gel profile of Cd-HuPrPSc derived from different CWD isolates.

Although our study clearly shows that CWD prions are capable of converting human PrPC into infectious PrPSc in vitro, the real-world implications are less clear due to several factors. First, the CWD-induced conversion of human PrPC into PrPSc was facilitated by repeated rounds of sonication in the PMCA procedure, which is unnatural. Second, in vivo prion clearing and selection mechanisms do not exist in the PMCA reactions, potentially making it easier for the newly converted PrPSc (including those that may be normally selected against in vivo) to persist and amplify in vitro. This could lead to the generation of PrPSc that is different from PrPSc generated in humanized mice after direct inoculation with brain homogenate from a CWD infected deer. Third, the PMCA substrates were derived from brain homogenates of only 4 non-CJD cases with PrP-129MM or -129VV. Finally, only a few CWD isolates from a limited number of cervid PRNP genotypes were examined. This makes it difficult to draw conclusions on the impact that other CWD strains and PRNP polymorphisms may have on the ability to convert human PrPC. More research will be needed to address these limitations.

In summary, our study demonstrates that CWD prions are able to cross the species barrier to convert human brain PrPC into infectious PrPSc in vitro. Although the Cd-HuPrPSc largely retains the glycoform pattern of the CWD prion seeds, they produced type 1 PrPres in the TgMM mice and type 2 PrPres in the TgVV mice, but with distinct PrPSc glycoform ratios and histopathological features. We believe that our findings establish a new venue to study the likely molecular and neuropathological features of potential acquired human CWD cases, which may provide critical clues for identification of the first human cases of CWD infection should they occur.

Availability of data and material

All materials used in this study will be made available subject to a material transfer agreement.

References

snip...end


***> CHRONIC WASTING DISEASE TSE PRP HUMANS ZOONOSIS ZOONOTIC <***

i thought i might share some news about cwd zoonosis that i got, that i cannot share or post to the public yet, i promised for various reasons, one that it will cause a shit storm for sure, but it was something i really already knew from previous studies, but, i was told that ;

==================

''As you can imagine, 2 and 5 (especially 5) may raise alarms.  The evidence we have for 4 are not as strong or tight as I would like to have.   At this point, please do not post any of the points publicly yet, but you can refer to points 1-3 in private discussions and all 5 points when discussing with relevant public officials to highlight the long-term risks of CWD zoonosis.''

====================

so, i figure your as about as official as it gets, and i think this science is extremely important for you to know and to converse about with your officials. it's about to burn a whole in my pocket. this is about as close as it will ever get for cwd zoonosis to be proven in my time, this and what Canada Czub et al found with the Macaques, plus an old study from cjd surveillance unit back that showed cjd and a 9% increase in risk from folks that eat venison, i will post all this below for your files Sir. i remember back in the BSE nvCJD days, from when the first BSE case in bovine was confirmed around 1984 maybe 83, i forget the good vets named that screwed it up first, Carol something, but from 83ish to 95 96 when nvCJD was linked to humans from BSE in cattle, so that took 10 to 15 years. hell, at that rate, especially with Texas and cwd zoonsis, hell, i'll be dead before it's official, if ever, so here ya go Sir. there was a grant study on cwd zoonosis that had been going on for some time, i followed it over the years, then the grant date for said study had expired, so, i thought i would write the good Professor about said study i.e. Professor Kong, CWRU et al. i will post the grant study abstract first, and then after that, what reply i got back, about said study that i was told not to post/publish...

CWD ZOONOSIS GRANT FIRST;

===============

Cervid to human prion transmission

Kong, Qingzhong 

Case Western Reserve University, Cleveland, OH, United States

 Abstract Prion disease is transmissible and invariably fatal. Chronic wasting disease (CWD) is the prion disease affecting deer, elk and moose, and it is a widespread and expanding epidemic affecting 22 US States and 2 Canadian provinces so far. CWD poses the most serious zoonotic prion transmission risks in North America because of huge venison consumption (>6 million deer/elk hunted and consumed annually in the USA alone), significant prion infectivity in muscles and other tissues/fluids from CWD-affected cervids, and usually high levels of individual exposure to CWD resulting from consumption of the affected animal among often just family and friends. However, we still do not know whether CWD prions can infect humans in the brain or peripheral tissues or whether clinical/asymptomatic CWD zoonosis has already occurred, and we have no essays to reliably detect CWD infection in humans. We hypothesize that: (1) The classic CWD prion strain can infect humans at low levels in the brain and peripheral lymphoid tissues; (2) The cervid-to-human transmission barrier is dependent on the cervid prion strain and influenced by the host (human) prion protein (PrP) primary sequence; (3) Reliable essays can be established to detect CWD infection in humans; and (4) CWD transmission to humans has already occurred. We will test these hypotheses in 4 Aims using transgenic (Tg) mouse models and complementary in vitro approaches. 

Aim 1 will prove that the classical CWD strain may infect humans in brain or peripheral lymphoid tissues at low levels by conducting systemic bioassays in a set of humanized Tg mouse lines expressing common human PrP variants using a number of CWD isolates at varying doses and routes. Experimental human CWD samples will also be generated for Aim 3. 

Aim 2 will test the hypothesis that the cervid-to-human prion transmission barrier is dependent on prion strain and influenced by the host (human) PrP sequence by examining and comparing the transmission efficiency and phenotypes of several atypical/unusual CWD isolates/strains as well as a few prion strains from other species that have adapted to cervid PrP sequence, utilizing the same panel of humanized Tg mouse lines as in Aim 1. 

Aim 3 will establish reliable essays for detection and surveillance of CWD infection in humans by examining in details the clinical, pathological, biochemical and in vitro seeding properties of existing and future experimental human CWD samples generated from Aims 1-2 and compare them with those of common sporadic human Creutzfeldt-Jakob disease (sCJD) prions. 

Aim 4 will attempt to detect clinical CWD-affected human cases by examining a significant number of brain samples from prion-affected human subjects in the USA and Canada who have consumed venison from CWD-endemic areas utilizing the criteria and essays established in Aim 3. The findings from this proposal will greatly advance our understandings on the potential and characteristics of cervid prion transmission in humans, establish reliable essays for CWD zoonosis and potentially discover the first case(s) of CWD infection in humans.

Public Health Relevance There are significant and increasing human exposure to cervid prions because chronic wasting disease (CWD, a widespread and highly infectious prion disease among deer and elk in North America) continues spreading and consumption of venison remains popular, but our understanding on cervid-to-human prion transmission is still very limited, raising public health concerns. This proposal aims to define the zoonotic risks of cervid prions and set up and apply essays to detect CWD zoonosis using mouse models and in vitro methods. The findings will greatly expand our knowledge on the potentials and characteristics of cervid prion transmission in humans, establish reliable essays for such infections and may discover the first case(s) of CWD infection in humans.

 Funding Agency Agency National Institute of Health (NIH) Institute National Institute of Neurological Disorders and Stroke (NINDS) Type Research Project (R01) Project # 1R01NS088604-01A1 Application # 9037884 Study Section Cellular and Molecular Biology of Neurodegeneration Study Section (CMND) Program Officer Wong, May Project Start 2015-09-30 Project End 2019-07-31 Budget Start 2015-09-30 Budget End 2016-07-31 Support Year 1 Fiscal Year 2015 Total Cost $337,507 Indirect Cost $118,756

snip... 


Professor Kongs reply to me just this month about above grant study that has NOT been published in peer reveiw yet...

=================================

Here is a brief summary of our findings:

snip...can't post, made a promise...tss

On Sat, Apr 3, 2021 at 12:19 PM Terry Singeltary <flounder9@verizon.net> wrote:

snip...

end...tss

==============

CWD ZOONOSIS THE FULL MONTY TO DATE

International Conference on Emerging Diseases, Outbreaks & Case Studies & 16th Annual Meeting on Influenza March 28-29, 2018 | Orlando, USA

Qingzhong Kong

Case Western Reserve University School of Medicine, USA

Zoonotic potential of chronic wasting disease prions from cervids

Chronic wasting disease (CWD) is the prion disease in cervids (mule deer, white-tailed deer, American elk, moose, and reindeer). It has become an epidemic in North America, and it has been detected in the Europe (Norway) since 2016. The widespread CWD and popular hunting and consumption of cervid meat and other products raise serious public health concerns, but questions remain on human susceptibility to CWD prions, especially on the potential difference in zoonotic potential among the various CWD prion strains. We have been working to address this critical question for well over a decade. We used CWD samples from various cervid species to inoculate transgenic mice expressing human or elk prion protein (PrP). We found infectious prions in the spleen or brain in a small fraction of CWD-inoculated transgenic mice expressing human PrP, indicating that humans are not completely resistant to CWD prions; this finding has significant ramifications on the public health impact of CWD prions. The influence of cervid PrP polymorphisms, the prion strain dependence of CWD-to-human transmission barrier, and the characterization of experimental human CWD prions will be discussed.

Speaker Biography Qingzhong Kong has completed his PhD from the University of Massachusetts at Amherst and Post-doctoral studies at Yale University. He is currently an Associate Professor of Pathology, Neurology and Regenerative Medicine. He has published over 50 original research papers in reputable journals (including Science Translational Medicine, JCI, PNAS and Cell Reports) and has been serving as an Editorial Board Member on seven scientific journals. He has multiple research interests, including public health risks of animal prions (CWD of cervids and atypical BSE of cattle), animal modeling of human prion diseases, mechanisms of prion replication and pathogenesis, etiology of sporadic Creutzfeldt-Jacob disease (CJD) in humans, normal cellular PrP in the biology and pathology of multiple brain and peripheral diseases, proteins responsible for the α-cleavage of cellular PrP, as well as gene therapy and DNA vaccination.






SUNDAY, JULY 25, 2021 

North American and Norwegian Chronic Wasting Disease prions exhibit different potential for interspecies transmission and zoonotic risk 

''Our data suggest that reindeer and red deer from Norway could be the most transmissible CWD prions to other mammals, whereas North American CWD prions were more prone to generate human prions in vitro.''


MONDAY, JULY 19, 2021 

***> U Calgary researchers at work on a vaccine against a fatal infectious disease affecting deer and potentially people


Prion Conference 2018 Abstracts

BSE aka MAD COW DISEASE, was first discovered in 1984, and it took until 1995 to finally admit that BSE was causing nvCJD, the rest there is history, but that science is still evolving i.e. science now shows that indeed atypical L-type BSE, atypical Nor-98 Scrapie, and typical Scrapie are all zoonosis, zoonotic for humans, there from. 

HOW long are we going to wait for Chronic Wasting Disease, CWD TSE Prion of Cervid, and zoonosis, zoonotic tranmission to humans there from?

Studies have shown since 1994 that humans are susceptible to CWD TSE Prion, so, what's the hold up with making CWD a zoonotic zoonosis disease, the iatrogenic transmissions there from is not waiting for someone to make a decision.

Prion Conference 2018 Abstracts

P190 Human prion disease mortality rates by occurrence of chronic wasting disease in freeranging cervids, United States

Abrams JY (1), Maddox RA (1), Schonberger LB (1), Person MK (1), Appleby BS (2), Belay ED (1)

(1) Centers for Disease Control and Prevention (CDC), National Center for Emerging and Zoonotic Infectious Diseases, Atlanta, GA, USA (2) Case Western Reserve University, National Prion Disease Pathology Surveillance Center (NPDPSC), Cleveland, OH, USA.

Background

Chronic wasting disease (CWD) is a prion disease of deer and elk that has been identified in freeranging cervids in 23 US states. While there is currently no epidemiological evidence for zoonotic transmission through the consumption of contaminated venison, studies suggest the CWD agent can cross the species barrier in experimental models designed to closely mimic humans. We compared rates of human prion disease in states with and without CWD to examine the possibility of undetermined zoonotic transmission.

Methods

Death records from the National Center for Health Statistics, case records from the National Prion Disease Pathology Surveillance Center, and additional state case reports were combined to create a database of human prion disease cases from 2003-2015. Identification of CWD in each state was determined through reports of positive CWD tests by state wildlife agencies. Age- and race-adjusted mortality rates for human prion disease, excluding cases with known etiology, were determined for four categories of states based on CWD occurrence: highly endemic (>16 counties with CWD identified in free-ranging cervids); moderately endemic (3-10 counties with CWD); low endemic (1-2 counties with CWD); and no CWD states. States were counted as having no CWD until the year CWD was first identified. Analyses stratified by age, sex, and time period were also conducted to focus on subgroups for which zoonotic transmission would be more likely to be detected: cases <55 years old, male sex, and the latter half of the study (2010-2015).

Results

Highly endemic states had a higher rate of prion disease mortality compared to non-CWD states (rate ratio [RR]: 1.12, 95% confidence interval [CI] = 1.01 - 1.23), as did low endemic states (RR: 1.15, 95% CI = 1.04 - 1.27). Moderately endemic states did not have an elevated mortality rate (RR: 1.05, 95% CI = 0.93 - 1.17). In age-stratified analyses, prion disease mortality rates among the <55 year old population were elevated for moderately endemic states (RR: 1.57, 95% CI = 1.10 – 2.24) while mortality rates were elevated among those ≥55 for highly endemic states (RR: 1.13, 95% CI = 1.02 - 1.26) and low endemic states (RR: 1.16, 95% CI = 1.04 - 1.29). In other stratified analyses, prion disease mortality rates for males were only elevated for low endemic states (RR: 1.27, 95% CI = 1.10 - 1.48), and none of the categories of CWD-endemic states had elevated mortality rates for the latter time period (2010-2015).

Conclusions

While higher prion disease mortality rates in certain categories of states with CWD in free-ranging cervids were noted, additional stratified analyses did not reveal markedly elevated rates for potentially sensitive subgroups that would be suggestive of zoonotic transmission. Unknown confounding factors or other biases may explain state-by-state differences in prion disease mortality.

=====

P172 Peripheral Neuropathy in Patients with Prion Disease

Wang H(1), Cohen M(1), Appleby BS(1,2)

(1) University Hospitals Cleveland Medical Center, Cleveland, Ohio (2) National Prion Disease Pathology Surveillance Center, Cleveland, Ohio.

Prion disease is a fatal progressive neurodegenerative disease due to deposition of an abnormal protease-resistant isoform of prion protein. Typical symptoms include rapidly progressive dementia, myoclonus, visual disturbance and hallucinations. Interestingly, in patients with prion disease, the abnormal protein canould also be found in the peripheral nervous system. Case reports of prion deposition in peripheral nerves have been reported. Peripheral nerve involvement is thought to be uncommon; however, little is known about the exact prevalence and features of peripheral neuropathy in patients with prion disease.

We reviewed autopsy-proven prion cases from the National Prion Disease Pathology Surveillance Center that were diagnosed between September 2016 to March 2017. We collected information regarding prion protein diagnosis, demographics, comorbidities, clinical symptoms, physical exam, neuropathology, molecular subtype, genetics lab, brain MRI, image and EMG reports. Our study included 104 patients. Thirteen (12.5%) patients had either subjective symptoms or objective signs of peripheral neuropathy. Among these 13 patients, 3 had other known potential etiologies of peripheral neuropathy such as vitamin B12 deficiency or prior chemotherapy. Among 10 patients that had no other clear etiology, 3 (30%) had familial CJD. The most common sCJD subtype was MV1-2 (30%), followed by MM1-2 (20%). The Majority of cases wasere male (60%). Half of them had exposure to wild game. The most common subjective symptoms were tingling and/or numbness of distal extremities. The most common objective finding was diminished vibratory sensation in the feet. Half of them had an EMG with the findings ranging from fasciculations to axonal polyneuropathy or demyelinating polyneuropathy.

Our study provides an overview of the pattern of peripheral neuropathy in patients with prion disease. Among patients with peripheral neuropathy symptoms or signs, majority has polyneuropathy. It is important to document the baseline frequency of peripheral neuropathy in prion diseases as these symptoms may become important when conducting surveillance for potential novel zoonotic prion diseases.

=====

P177 PrP plaques in methionine homozygous Creutzfeldt-Jakob disease patients as a potential marker of iatrogenic transmission

Abrams JY (1), Schonberger LB (1), Cali I (2), Cohen Y (2), Blevins JE (2), Maddox RA (1), Belay ED (1), Appleby BS (2), Cohen ML (2)

(1) Centers for Disease Control and Prevention (CDC), National Center for Emerging and Zoonotic Infectious Diseases, Atlanta, GA, USA (2) Case Western Reserve University, National Prion Disease Pathology Surveillance Center (NPDPSC), Cleveland, OH, USA.

Background

Sporadic Creutzfeldt-Jakob disease (CJD) is widely believed to originate from de novo spontaneous conversion of normal prion protein (PrP) to its pathogenic form, but concern remains that some reported sporadic CJD cases may actually be caused by disease transmission via iatrogenic processes. For cases with methionine homozygosity (CJD-MM) at codon 129 of the PRNP gene, recent research has pointed to plaque-like PrP deposition as a potential marker of iatrogenic transmission for a subset of cases. This phenotype is theorized to originate from specific iatrogenic source CJD types that comprise roughly a quarter of known CJD cases.

Methods

We reviewed scientific literature for studies which described PrP plaques among CJD patients with known epidemiological links to iatrogenic transmission (receipt of cadaveric human grown hormone or dura mater), as well as in cases of reported sporadic CJD. The presence and description of plaques, along with CJD classification type and other contextual factors, were used to summarize the current evidence regarding plaques as a potential marker of iatrogenic transmission. In addition, 523 cases of reported sporadic CJD cases in the US from January 2013 through September 2017 were assessed for presence of PrP plaques.

Results

We identified four studies describing 52 total cases of CJD-MM among either dura mater recipients or growth hormone recipients, of which 30 were identified as having PrP plaques. While sporadic cases were not generally described as having plaques, we did identify case reports which described plaques among sporadic MM2 cases as well as case reports of plaques exclusively in white matter among sporadic MM1 cases. Among the 523 reported sporadic CJD cases, 0 of 366 MM1 cases had plaques, 2 of 48 MM2 cases had kuru plaques, and 4 of 109 MM1+2 cases had either kuru plaques or both kuru and florid plaques. Medical chart review of the six reported sporadic CJD cases with plaques did not reveal clinical histories suggestive of potential iatrogenic transmission.

Conclusions

PrP plaques occur much more frequently for iatrogenic CJD-MM cases compared to sporadic CJDMM cases. Plaques may indicate iatrogenic transmission for CJD-MM cases without a type 2 Western blot fragment. The study results suggest the absence of significant misclassifications of iatrogenic CJD as sporadic. To our knowledge, this study is the first to describe grey matter kuru plaques in apparently sporadic CJD-MM patients with a type 2 Western blot fragment.

=====

P180 Clinico-pathological analysis of human prion diseases in a brain bank series

Ximelis T (1), Aldecoa I (1,2), Molina-Porcel L (1,3), Grau-Rivera O (4), Ferrer I (5), Nos C (6), Gelpi E (1,7), Sánchez-Valle R (1,4)

(1) Neurological Tissue Bank of the Biobanc-Hospital ClÃnic-IDIBAPS, Barcelona, Spain (2) Pathological Service of Hospital ClÃnic de Barcelona, Barcelona, Spain (3) EAIA Trastorns Cognitius, Centre Emili Mira, Parc de Salut Mar, Barcelona, Spain (4) Department of Neurology of Hospital ClÃnic de Barcelona, Barcelona, Spain (5) Institute of Neuropathology, Hospital Universitari de Bellvitge, Hospitalet de Llobregat, Barcelona (6) General subdirectorate of Surveillance and Response to Emergencies in Public Health, Department of Public Health in Catalonia, Barcelona, Spain (7) Institute of Neurology, Medical University of Vienna, Vienna, Austria.

Background and objective:

The Neurological Tissue Bank (NTB) of the Hospital Clínic-Institut d‘Investigacions Biomèdiques August Pi i Sunyer, Barcelona, Spain is the reference center in Catalonia for the neuropathological study of prion diseases in the region since 2001. The aim of this study is to analyse the characteristics of the confirmed prion diseases registered at the NTB during the last 15 years.

Methods:

We reviewed retrospectively all neuropathologically confirmed cases registered during the period January 2001 to December 2016.

Results:

176 cases (54,3% female, mean age: 67,5 years and age range: 25-86 years) of neuropathological confirmed prion diseases have been studied at the NTB. 152 cases corresponded to sporadic Creutzfeldt-Jakob disease (sCJD), 10 to genetic CJD, 10 to Fatal Familial Insomnia, 2 to GerstmannSträussler-Scheinker disease, and 2 cases to variably protease-sensitive prionopathy (VPSPr). Within sCJD subtypes the MM1 subtype was the most frequent, followed by the VV2 histotype.

Clinical and neuropathological diagnoses agreed in 166 cases (94%). The clinical diagnosis was not accurate in 10 patients with definite prion disease: 1 had a clinical diagnosis of Fronto-temporal dementia (FTD), 1 Niemann-Pick‘s disease, 1 Lewy Body‘s Disease, 2 Alzheimer‘s disease, 1 Cortico-basal syndrome and 2 undetermined dementia. Among patients with VPSPr, 1 had a clinical diagnosis of Amyotrophic lateral sclerosis (ALS) and the other one with FTD.

Concomitant pathologies are frequent in older age groups, mainly AD neuropathological changes were observed in these subjects.

Discussion:

A wide spectrum of human prion diseases have been identified in the NTB being the relative frequencies and main characteristics like other published series. There is a high rate of agreement between clinical and neuropathological diagnoses with prion diseases. These findings show the importance that public health has given to prion diseases during the past 15 years. Continuous surveillance of human prion disease allows identification of new emerging phenotypes. Brain tissue samples from these donors are available to the scientific community. For more information please visit:


=====

P192 Prion amplification techniques for the rapid evaluation of surface decontamination procedures

Bruyere-Ostells L (1), Mayran C (1), Belondrade M (1), Boublik Y (2), Haïk S (3), Fournier-Wirth C (1), Nicot S (1), Bougard D (1)

(1) Pathogenesis and control of chronic infections, Etablissement Français du Sang, Inserm, Université de Montpellier, Montpellier, France. (2) Centre de Recherche en Biologie cellulaire de Montpellier, CNRS, Université de Montpellier, Montpellier, France. (3) Inserm U 1127, CNRS UMR 7225, Sorbonne Universités, UPMC Université Paris 06 UMR S 1127, Institut du Cerveau et de la Moelle épinière, ICM, Paris, France.

Aims:

Transmissible Spongiform Encephalopathies (TSE) or prion diseases are a group of incurable and always fatal neurodegenerative disorders including Creutzfeldt-Jakob diseases (CJD) in humans. These pathologies include sporadic (sCJD), genetic and acquired (variant CJD) forms. By the past, sCJD and vCJD were transmitted by different prion contaminated biological materials to patients resulting in more than 400 iatrogenic cases (iCJD). The atypical nature and the biochemical properties of the infectious agent, formed by abnormal prion protein or PrPTSE, make it particularly resistant to conventional decontamination procedures. In addition, PrPTSE is widely distributed throughout the organism before clinical onset in vCJD and can also be detected in some peripheral tissues in sporadic CJD. Risk of iatrogenic transmission of CJD by contaminated medical device remains thus a concern for healthcare facilities. Bioassay is the gold standard method to evaluate the efficacy of prion decontamination procedures but is time-consuming and expensive. Here, we propose to compare in vitro prion amplification techniques: Protein Misfolding Cyclic Amplification (PMCA) and Real-Time Quaking Induced Conversion (RT-QuIC) for the detection of residual prions on surface after decontamination.

Methods:

Stainless steel wires, by mimicking the surface of surgical instruments, were proposed as a carrier model of prions for inactivation studies. To determine the sensitivity of the two amplification techniques on wires (Surf-PMCA and Surf-QuIC), steel wires were therefore contaminated with serial dilutions of brain homogenates (BH) from a 263k infected hamster and from a patient with sCJD (MM1 subtype). We then compared the different standard decontamination procedures including partially and fully efficient treatments by detecting the residual seeding activity on 263K and sCJD contaminated wires. We completed our study by the evaluation of marketed reagents endorsed for prion decontamination.

Results:

The two amplification techniques can detect minute quantities of PrPTSE adsorbed onto a single wire. 8/8 wires contaminated with a 10-6 dilution of 263k BH and 1/6 with the 10-8 dilution are positive with Surf-PMCA. Similar performances were obtained with Surf-QuIC on 263K: 10/16 wires contaminated with 10-6 dilution and 1/8 wires contaminated with 10-8 dilution are positive. Regarding the human sCJD-MM1 prion, Surf-QuIC allows us to detect 16/16 wires contaminated with 10-6 dilutions and 14/16 with 10-7 . Results obtained after decontamination treatments are very similar between 263K and sCJD prions. Efficiency of marketed treatments to remove prions is lower than expected.

Conclusions:

Surf-PMCA and Surf-QuIC are very sensitive methods for the detection of prions on wires and could be applied to prion decontamination studies for rapid evaluation of new treatments. Sodium hypochlorite is the only product to efficiently remove seeding activity of both 263K and sCJD prions.

=====

WA2 Oral transmission of CWD into Cynomolgus macaques: signs of atypical disease, prion conversion and infectivity in macaques and bio-assayed transgenic mice

Schatzl HM (1, 2), Hannaoui S (1, 2), Cheng Y-C (1, 2), Gilch S (1, 2), Beekes M (3), SchulzSchaeffer W (4), Stahl-Hennig C (5) and Czub S (2, 6)

(1) University of Calgary, Calgary Prion Research Unit, Calgary, Canada (2) University of Calgary, Faculty of Veterinary Medicine, Calgary, Canada, (3) Robert Koch Institute, Berlin, Germany, (4) University of Homburg/Saar, Homburg, Germany, (5) German Primate Center, Goettingen, Germany, (6) Canadian Food Inspection Agency (CFIA), Lethbridge, Canada.

To date, BSE is the only example of interspecies transmission of an animal prion disease into humans. The potential zoonotic transmission of CWD is an alarming issue and was addressed by many groups using a variety of in vitro and in vivo experimental systems. Evidence from these studies indicated a substantial, if not absolute, species barrier, aligning with the absence of epidemiological evidence suggesting transmission into humans. Studies in non-human primates were not conclusive so far, with oral transmission into new-world monkeys and no transmission into old-world monkeys. Our consortium has challenged 18 Cynomolgus macaques with characterized CWD material, focusing on oral transmission with muscle tissue. Some macaques have orally received a total of 5 kg of muscle material over a period of 2 years. After 5-7 years of incubation time some animals showed clinical symptoms indicative of prion disease, and prion neuropathology and PrPSc deposition were found in spinal cord and brain of euthanized animals. PrPSc in immunoblot was weakly detected in some spinal cord materials and various tissues tested positive in RT-QuIC, including lymph node and spleen homogenates. To prove prion infectivity in the macaque tissues, we have intracerebrally inoculated 2 lines of transgenic mice, expressing either elk or human PrP. At least 3 TgElk mice, receiving tissues from 2 different macaques, showed clinical signs of a progressive prion disease and brains were positive in immunoblot and RT-QuIC. Tissues (brain, spinal cord and spleen) from these and preclinical mice are currently tested using various read-outs and by second passage in mice. Transgenic mice expressing human PrP were so far negative for clear clinical prion disease (some mice >300 days p.i.). In parallel, the same macaque materials are inoculated into bank voles. Taken together, there is strong evidence of transmissibility of CWD orally into macaques and from macaque tissues into transgenic mouse models, although with an incomplete attack rate. The clinical and pathological presentation in macaques was mostly atypical, with a strong emphasis on spinal cord pathology. Our ongoing studies will show whether the transmission of CWD into macaques and passage in transgenic mice represents a form of non-adaptive prion amplification, and whether macaque-adapted prions have the potential to infect mice expressing human PrP. The notion that CWD can be transmitted orally into both new-world and old-world non-human primates asks for a careful reevaluation of the zoonotic risk of CWD.

See also poster P103

***> The notion that CWD can be transmitted orally into both new-world and old-world non-human primates asks for a careful reevaluation of the zoonotic risk of CWD.

=====

WA16 Monitoring Potential CWD Transmission to Humans

Belay ED

Centers for Disease Control and Prevention (CDC), National Center for Emerging and Zoonotic Infectious Diseases, Atlanta, GA, USA.

The spread of chronic wasting disease (CWD) in animals has raised concerns about increasing human exposure to the CWD agent via hunting and venison consumption, potentially facilitating CWD transmission to humans. Several studies have explored this possibility, including limited epidemiologic studies, in vitro experiments, and laboratory studies using various types of animal models. Most human exposures to the CWD agent in the United States would be expected to occur in association with deer and elk hunting in CWD-endemic areas. The Centers for Disease Control and Prevention (CDC) collaborated with state health departments in Colorado, Wisconsin, and Wyoming to identify persons at risk of CWD exposure and to monitor their vital status over time. Databases were established of persons who hunted in Colorado and Wyoming and those who reported consumption of venison from deer that later tested positive in Wisconsin. Information from the databases is periodically cross-checked with mortality data to determine the vital status and causes of death for deceased persons. Long-term follow-up of these hunters is needed to assess their risk of development of a prion disease linked to CWD exposure.

=====

P166 Characterization of CJD strain profiles in venison consumers and non-consumers from Alberta and Saskatchewan

Stephanie Booth (1,2), Lise Lamoureux (1), Debra Sorensen (1), Jennifer L. Myskiw (1,2), Megan Klassen (1,2), Michael Coulthart (3), Valerie Sim (4)

(1) Zoonotic Diseases and Special Pathogens, National Microbiology Laboratory, Public Health Agency of Canada, Winnipeg (2) Department of Medical Microbiology and Infectious Diseases, University of Manitoba, Winnipeg (3) Canadian CJD Surveillance System, Public Health Agency of Canada, Ottawa (4) Division of Neurology, Department of Medicine Centre for Prions and Protein Folding Diseases, University of Alberta, Edmonton.

Chronic wasting disease (CWD) is spreading rapidly through wild cervid populations in the Canadian provinces of Alberta and Saskatchewan. While this has implications for tourism and hunting, there is also concern over possible zoonotic transmission to humans who eat venison from infected deer. Whilst there is no evidence of any human cases of CWD to date, the Canadian CJD Surveillance System (CJDSS) in Canada is staying vigilant. When variant CJD occurred following exposure to BSE, the unique biochemical fingerprint of the pathologic PrP enabled a causal link to be confirmed. However, we cannot be sure what phenotype human CWD prions would present with, or indeed, whether this would be distinct from that see in sporadic CJD. Therefore we are undertaking a systematic analysis of the molecular diversity of CJD cases of individuals who resided in Alberta and Saskatchewan at their time of death comparing venison consumers and non-consumers, using a variety of clinical, imaging, pathological and biochemical markers. Our initial objective is to develop novel biochemical methodologies that will extend the baseline glycoform and genetic polymorphism typing that is already completed by the CJDSS. Firstly, we are reviewing MRI, EEG and pathology information from over 40 cases of CJD to select clinically affected areas for further investigation. Biochemical analysis will include assessment of the levels of protease sensitive and resistant prion protein, glycoform typing using 2D gel electrophoresis, testing seeding capabilities and kinetics of aggregation by quaking-induced conversion, and determining prion oligomer size distributions with asymmetric flow field fractionation with in-line light scattering. Progress and preliminary data will be presented. Ultimately, we intend to further define the relationship between PrP structure and disease phenotype and establish a baseline for the identification of future atypical CJD cases that may arise as a result of exposure to CWD.

=====

Source Prion Conference 2018 Abstracts




Volume 24, Number 8—August 2018 Research Susceptibility of Human Prion Protein to Conversion by Chronic Wasting Disease Prions

Marcelo A. BarriaComments to Author , Adriana Libori, Gordon Mitchell, and Mark W. Head Author affiliations: National CJD Research and Surveillance Unit, University of Edinburgh, Edinburgh, Scotland, UK (M.A. Barria, A. Libori, M.W. Head); National and OIE Reference Laboratory for Scrapie and CWD, Canadian Food Inspection Agency, Ottawa, Ontario, Canada (G. Mitchell)

Abstract Chronic wasting disease (CWD) is a contagious and fatal neurodegenerative disease and a serious animal health issue for deer and elk in North America. The identification of the first cases of CWD among free-ranging reindeer and moose in Europe brings back into focus the unresolved issue of whether CWD can be zoonotic like bovine spongiform encephalopathy. We used a cell-free seeded protein misfolding assay to determine whether CWD prions from elk, white-tailed deer, and reindeer in North America can convert the human prion protein to the disease-associated form. We found that prions can convert, but the efficiency of conversion is affected by polymorphic variation in the cervid and human prion protein genes. In view of the similarity of reindeer, elk, and white-tailed deer in North America to reindeer, red deer, and roe deer, respectively, in Europe, a more comprehensive and thorough assessment of the zoonotic potential of CWD might be warranted.

snip...

Discussion Characterization of the transmission properties of CWD and evaluation of their zoonotic potential are important for public health purposes. Given that CWD affects several members of the family Cervidae, it seems reasonable to consider whether the zoonotic potential of CWD prions could be affected by factors such as CWD strain, cervid species, geographic location, and Prnp–PRNP polymorphic variation. We have previously used an in vitro conversion assay (PMCA) to investigate the susceptibility of the human PrP to conversion to its disease-associated form by several animal prion diseases, including CWD (15,16,22). The sensitivity of our molecular model for the detection of zoonotic conversion depends on the combination of 1) the action of proteinase K to degrade the abundant human PrPC that constitutes the substrate while only N terminally truncating any human PrPres produced and 2) the presence of the 3F4 epitope on human but not cervid PrP. In effect, this degree of sensitivity means that any human PrPres formed during the PMCA reaction can be detected down to the limit of Western blot sensitivity. In contrast, if other antibodies that detect both cervid and human PrP are used, such as 6H4, then newly formed human PrPres must be detected as a measurable increase in PrPres over the amount remaining in the reaction product from the cervid seed. Although best known for the efficient amplification of prions in research and diagnostic contexts, the variation of the PMCA method employed in our study is optimized for the definitive detection of zoonotic reaction products of inherently inefficient conversion reactions conducted across species barriers. By using this system, we previously made and reported the novel observation that elk CWD prions could convert human PrPC from human brain and could also convert recombinant human PrPC expressed in transgenic mice and eukaryotic cell cultures (15).

A previous publication suggested that mule deer PrPSc was unable to convert humanized transgenic substrate in PMCA assays (23) and required a further step of in vitro conditioning in deer substrate PMCA before it was able to cross the deer–human molecular barrier (24). However, prions from other species, such as elk (15) and reindeer affected by CWD, appear to be compatible with the human protein in a single round of amplification (as shown in our study). These observations suggest that different deer species affected by CWD could present differing degrees of the olecular compatibility with the normal form of human PrP.

The contribution of the polymorphism at codon 129 of the human PrP gene has been extensively studied and is recognized as a risk factor for Creutzfeldt-Jakob disease (4). In cervids, the equivalent codon corresponds to the position 132 encoding methionine or leucine. This polymorphism in the elk gene has been shown to play an important role in CWD susceptibility (25,26). We have investigated the effect of this cervid Prnp polymorphism on the conversion of the humanized transgenic substrate according to the variation in the equivalent PRNP codon 129 polymorphism. Interestingly, only the homologs methionine homozygous seed–substrate reactions could readily convert the human PrP, whereas the heterozygous elk PrPSc was unable to do so, even though comparable amounts of PrPres were used to seed the reaction. In addition, we observed only low levels of human PrPres formation in the reactions seeded with the homozygous methionine (132 MM) and the heterozygous (132 ML) seeds incubated with the other 2 human polymorphic substrates (129 MV and 129 VV). The presence of the amino acid leucine at position 132 of the elk Prnp gene has been attributed to a lower degree of prion conversion compared with methionine on the basis of experiments in mice made transgenic for these polymorphic variants (26). Considering the differences observed for the amplification of the homozygous human methionine substrate by the 2 polymorphic elk seeds (MM and ML), reappraisal of the susceptibility of human PrPC by the full range of cervid polymorphic variants affected by CWD would be warranted.

In light of the recent identification of the first cases of CWD in Europe in a free-ranging reindeer (R. tarandus) in Norway (2), we also decided to evaluate the in vitro conversion potential of CWD in 2 experimentally infected reindeer (18). Formation of human PrPres was readily detectable after a single round of PMCA, and in all 3 humanized polymorphic substrates (MM, MV, and VV). This finding suggests that CWD prions from reindeer could be more compatible with human PrPC generally and might therefore present a greater risk for zoonosis than, for example, CWD prions from white-tailed deer. A more comprehensive comparison of CWD in the affected species, coupled with the polymorphic variations in the human and deer PRNP–Prnp genes, in vivo and in vitro, will be required before firm conclusions can be drawn. Analysis of the Prnp sequence of the CWD reindeer in Norway was reported to be identical to the specimens used in our study (2). This finding raises the possibility of a direct comparison of zoonotic potential between CWD acquired in the wild and that produced in a controlled laboratory setting. (Table).

The prion hypothesis proposes that direct molecular interaction between PrPSc and PrPC is necessary for conversion and prion replication. Accordingly, polymorphic variants of the PrP of host and agent might play a role in determining compatibility and potential zoonotic risk. In this study, we have examined the capacity of the human PrPC to support in vitro conversion by elk, white-tailed deer, and reindeer CWD PrPSc. Our data confirm that elk CWD prions can convert the human PrPC, at least in vitro, and show that the homologous PRNP polymorphisms at codon 129 and 132 in humans and cervids affect conversion efficiency. Other species affected by CWD, particularly caribou or reindeer, also seem able to convert the human PrP. It will be important to determine whether other polymorphic variants found in other CWD-affected Cervidae or perhaps other factors (17) exert similar effects on the ability to convert human PrP and thus affect their zoonotic potential.

Dr. Barria is a research scientist working at the National CJD Research and Surveillance Unit, University of Edinburgh. His research has focused on understanding the molecular basis of a group of fatal neurologic disorders called prion diseases.

Acknowledgments We thank Aru Balachandran for originally providing cervid brain tissues, Abigail Diack and Jean Manson for providing mouse brain tissue, and James Ironside for his critical reading of the manuscript at an early stage.

This report is independent research commissioned and funded by the United Kingdom’s Department of Health Policy Research Programme and the Government of Scotland. The views expressed in this publication are those of the authors and not necessarily those of the Department of Health or the Government of Scotland.

Author contributions: The study was conceived and designed by M.A.B. and M.W.H. The experiments were conducted by M.A.B. and A.L. Chronic wasting disease brain specimens were provided by G.M. The manuscript was written by M.A.B. and M.W.H. All authors contributed to the editing and revision of the manuscript.



Prion 2017 Conference Abstracts
First evidence of intracranial and peroral transmission of Chronic Wasting Disease (CWD) into Cynomolgus macaques: a work in progress Stefanie Czub1, Walter Schulz-Schaeffer2, Christiane Stahl-Hennig3, Michael Beekes4, Hermann Schaetzl5 and Dirk Motzkus6 1 
University of Calgary Faculty of Veterinary Medicine/Canadian Food Inspection Agency; 2Universitatsklinikum des Saarlandes und Medizinische Fakultat der Universitat des Saarlandes; 3 Deutsches Primaten Zentrum/Goettingen; 4 Robert-Koch-Institut Berlin; 5 University of Calgary Faculty of Veterinary Medicine; 6 presently: Boehringer Ingelheim Veterinary Research Center; previously: Deutsches Primaten Zentrum/Goettingen 
This is a progress report of a project which started in 2009. 
21 cynomolgus macaques were challenged with characterized CWD material from white-tailed deer (WTD) or elk by intracerebral (ic), oral, and skin exposure routes. Additional blood transfusion experiments are supposed to assess the CWD contamination risk of human blood product. Challenge materials originated from symptomatic cervids for ic, skin scarification and partially per oral routes (WTD brain). Challenge material for feeding of muscle derived from preclinical WTD and from preclinical macaques for blood transfusion experiments. We have confirmed that the CWD challenge material contained at least two different CWD agents (brain material) as well as CWD prions in muscle-associated nerves. 
Here we present first data on a group of animals either challenged ic with steel wires or per orally and sacrificed with incubation times ranging from 4.5 to 6.9 years at postmortem. Three animals displayed signs of mild clinical disease, including anxiety, apathy, ataxia and/or tremor. In four animals wasting was observed, two of those had confirmed diabetes. All animals have variable signs of prion neuropathology in spinal cords and brains and by supersensitive IHC, reaction was detected in spinal cord segments of all animals. Protein misfolding cyclic amplification (PMCA), real-time quaking-induced conversion (RT-QuiC) and PET-blot assays to further substantiate these findings are on the way, as well as bioassays in bank voles and transgenic mice. 
At present, a total of 10 animals are sacrificed and read-outs are ongoing. Preclinical incubation of the remaining macaques covers a range from 6.4 to 7.10 years. Based on the species barrier and an incubation time of > 5 years for BSE in macaques and about 10 years for scrapie in macaques, we expected an onset of clinical disease beyond 6 years post inoculation. 
PRION 2017 DECIPHERING NEURODEGENERATIVE DISORDERS ABSTRACTS REFERENCE
8. Even though human TSE‐exposure risk through consumption of game from European cervids can be assumed to be minor, if at all existing, no final conclusion can be drawn due to the overall lack of scientific data. In particular the US data do not clearly exclude the possibility of human (sporadic or familial) TSE development due to consumption of venison. The Working Group thus recognizes a potential risk to consumers if a TSE would be present in European cervids. It might be prudent considering appropriate measures to reduce such a risk, e.g. excluding tissues such as CNS and lymphoid tissues from the human food chain, which would greatly reduce any potential risk for consumers. However, it is stressed that currently, no data regarding a risk of TSE infections from cervid products are available.


SATURDAY, FEBRUARY 23, 2019 

Chronic Wasting Disease CWD TSE Prion and THE FEAST 2003 CDC an updated review of the science 2019


TUESDAY, NOVEMBER 04, 2014 

Six-year follow-up of a point-source exposure to CWD contaminated venison in an Upstate New York community: risk behaviours and health outcomes 2005–2011

Authors, though, acknowledged the study was limited in geography and sample size and so it couldn't draw a conclusion about the risk to humans. They recommended more study. Dr. Ermias Belay was the report's principal author but he said New York and Oneida County officials are following the proper course by not launching a study. "There's really nothing to monitor presently. No one's sick," Belay said, noting the disease's incubation period in deer and elk is measured in years. "


Transmission Studies

Mule deer transmissions of CWD were by intracerebral inoculation and compared with natural cases {the following was written but with a single line marked through it ''first passage (by this route)}....TSS

resulted in a more rapidly progressive clinical disease with repeated episodes of synocopy ending in coma. One control animal became affected, it is believed through contamination of inoculum (?saline). Further CWD transmissions were carried out by Dick Marsh into ferret, mink and squirrel monkey. Transmission occurred in ALL of these species with the shortest incubation period in the ferret.

snip.... 


Prion Infectivity in Fat of Deer with Chronic Wasting Disease▿ 

Brent Race#, Kimberly Meade-White#, Richard Race and Bruce Chesebro* + Author Affiliations

In mice, prion infectivity was recently detected in fat. Since ruminant fat is consumed by humans and fed to animals, we determined infectivity titers in fat from two CWD-infected deer. Deer fat devoid of muscle contained low levels of CWD infectivity and might be a risk factor for prion infection of other species. 


Prions in Skeletal Muscles of Deer with Chronic Wasting Disease 

Here bioassays in transgenic mice expressing cervid prion protein revealed the presence of infectious prions in skeletal muscles of CWD-infected deer, demonstrating that humans consuming or handling meat from CWD-infected deer are at risk to prion exposure. 


*** now, let’s see what the authors said about this casual link, personal communications years ago, and then the latest on the zoonotic potential from CWD to humans from the TOKYO PRION 2016 CONFERENCE.

see where it is stated NO STRONG evidence. so, does this mean there IS casual evidence ???? “Our conclusion stating that we found no strong evidence of CWD transmission to humans”

From: TSS 

Subject: CWD aka MAD DEER/ELK TO HUMANS ???

Date: September 30, 2002 at 7:06 am PST

From: "Belay, Ermias"

To: Cc: "Race, Richard (NIH)" ; ; "Belay, Ermias"

Sent: Monday, September 30, 2002 9:22 AM

Subject: RE: TO CDC AND NIH - PUB MED- 3 MORE DEATHS - CWD - YOUNG HUNTERS

Dear Sir/Madam,

In the Archives of Neurology you quoted (the abstract of which was attached to your email), we did not say CWD in humans will present like variant CJD.. That assumption would be wrong. I encourage you to read the whole article and call me if you have questions or need more clarification (phone: 404-639-3091). Also, we do not claim that "no-one has ever been infected with prion disease from eating venison." Our conclusion stating that we found no strong evidence of CWD transmission to humans in the article you quoted or in any other forum is limited to the patients we investigated.

Ermias Belay, M.D. Centers for Disease Control and Prevention

-----Original Message-----

From: Sent: Sunday, September 29, 2002 10:15 AM


Subject: TO CDC AND NIH - PUB MED- 3 MORE DEATHS - CWD - YOUNG HUNTERS

Sunday, November 10, 2002 6:26 PM .......snip........end..............TSS

Thursday, April 03, 2008

A prion disease of cervids: Chronic wasting disease 2008 1: Vet Res. 2008 Apr 3;39(4):41 A prion disease of cervids: Chronic wasting disease Sigurdson CJ.

snip...

*** twenty-seven CJD patients who regularly consumed venison were reported to the Surveillance Center***,

snip... full text ; 


> However, to date, no CWD infections have been reported in people. 

sporadic, spontaneous CJD, 85%+ of all human TSE, did not just happen. never in scientific literature has this been proven.

if one looks up the word sporadic or spontaneous at pubmed, you will get a laundry list of disease that are classified in such a way;



key word here is 'reported'. science has shown that CWD in humans will look like sporadic CJD. SO, how can one assume that CWD has not already transmitted to humans? they can't, and it's as simple as that. from all recorded science to date, CWD has already transmitted to humans, and it's being misdiagnosed as sporadic CJD. ...terry 

*** LOOKING FOR CWD IN HUMANS AS nvCJD or as an ATYPICAL CJD, LOOKING IN ALL THE WRONG PLACES $$$ ***

> However, to date, no CWD infections have been reported in people.
key word here is ‘reported’. science has shown that CWD in humans will look like sporadic CJD. SO, how can one assume that CWD has not already transmitted to humans? they can’t, and it’s as simple as that. from all recorded science to date, CWD has already transmitted to humans, and it’s being misdiagnosed as sporadic CJD. …terry
*** LOOKING FOR CWD IN HUMANS AS nvCJD or as an ATYPICAL CJD, LOOKING IN ALL THE WRONG PLACES $$$ ***
*** These results would seem to suggest that CWD does indeed have zoonotic potential, at least as judged by the compatibility of CWD prions and their human PrPC target. Furthermore, extrapolation from this simple in vitro assay suggests that if zoonotic CWD occurred, it would most likely effect those of the PRNP codon 129-MM genotype and that the PrPres type would be similar to that found in the most common subtype of sCJD (MM1).***
CWD TSE PRION AND ZOONOTIC, ZOONOSIS, POTENTIAL

Subject: Re: DEER SPONGIFORM ENCEPHALOPATHY SURVEY & HOUND STUDY 

Date: Fri, 18 Oct 2002 23:12:22 +0100 

From: Steve Dealler 

Reply-To: Bovine Spongiform Encephalopathy Organization: Netscape Online member 

To: BSE-L@ References: <3daf5023 .4080804="" wt.net="">

Dear Terry,

An excellent piece of review as this literature is desparately difficult to get back from Government sites.

What happened with the deer was that an association between deer meat eating and sporadic CJD was found in about 1993. The evidence was not great but did not disappear after several years of asking CJD cases what they had eaten. I think that the work into deer disease largely stopped because it was not helpful to the UK industry...and no specific cases were reported. Well, if you dont look adequately like they are in USA currenly then you wont find any!

Steve Dealler =============== 


''The association between venison eating and risk of CJD shows similar pattern, with regular venison eating associated with a 9 FOLD INCREASE IN RISK OF CJD (p = 0.04).''

CREUTZFELDT JAKOB DISEASE SURVEILLANCE IN THE UNITED KINGDOM THIRD ANNUAL REPORT AUGUST 1994

Consumption of venison and veal was much less widespread among both cases and controls. For both of these meats there was evidence of a trend with increasing frequency of consumption being associated with increasing risk of CJD. (not nvCJD, but sporadic CJD...tss) These associations were largely unchanged when attention was restricted to pairs with data obtained from relatives. ...

Table 9 presents the results of an analysis of these data.

There is STRONG evidence of an association between ‘’regular’’ veal eating and risk of CJD (p = .0.01).

Individuals reported to eat veal on average at least once a year appear to be at 13 TIMES THE RISK of individuals who have never eaten veal.

There is, however, a very wide confidence interval around this estimate. There is no strong evidence that eating veal less than once per year is associated with increased risk of CJD (p = 0.51).

The association between venison eating and risk of CJD shows similar pattern, with regular venison eating associated with a 9 FOLD INCREASE IN RISK OF CJD (p = 0.04).

There is some evidence that risk of CJD INCREASES WITH INCREASING FREQUENCY OF LAMB EATING (p = 0.02).

The evidence for such an association between beef eating and CJD is weaker (p = 0.14). When only controls for whom a relative was interviewed are included, this evidence becomes a little STRONGER (p = 0.08).

snip...

It was found that when veal was included in the model with another exposure, the association between veal and CJD remained statistically significant (p = < 0.05 for all exposures), while the other exposures ceased to be statistically significant (p = > 0.05).

snip...

In conclusion, an analysis of dietary histories revealed statistical associations between various meats/animal products and INCREASED RISK OF CJD. When some account was taken of possible confounding, the association between VEAL EATING AND RISK OF CJD EMERGED AS THE STRONGEST OF THESE ASSOCIATIONS STATISTICALLY. ...

snip...

In the study in the USA, a range of foodstuffs were associated with an increased risk of CJD, including liver consumption which was associated with an apparent SIX-FOLD INCREASE IN THE RISK OF CJD. By comparing the data from 3 studies in relation to this particular dietary factor, the risk of liver consumption became non-significant with an odds ratio of 1.2 (PERSONAL COMMUNICATION, PROFESSOR A. HOFMAN. ERASMUS UNIVERSITY, ROTTERDAM). (???...TSS)

snip...see full report ;




Stephen Dealler is a consultant medical microbiologist  deal@airtime.co.uk 

BSE Inquiry Steve Dealler

Management In Confidence

BSE: Private Submission of Bovine Brain Dealler

snip...see full text;

MONDAY, FEBRUARY 25, 2019

***> MAD DOGS AND ENGLISHMEN BSE, SCRAPIE, CWD, CJD, TSE PRION A REVIEW 2019


***> ''The association between venison eating and risk of CJD shows similar pattern, with regular venison eating associated with a 9 FOLD INCREASE IN RISK OF CJD (p = 0.04).''

***> In conclusion, sensory symptoms and loss of reflexes in Gerstmann-Sträussler-Scheinker syndrome can be explained by neuropathological changes in the spinal cord. We conclude that the sensory symptoms and loss of lower limb reflexes in Gerstmann-Sträussler-Scheinker syndrome is due to pathology in the caudal spinal cord. <***

***> The clinical and pathological presentation in macaques was mostly atypical, with a strong emphasis on spinal cord pathology.<*** 

***> The notion that CWD can be transmitted orally into both new-world and old-world non-human primates asks for a careful reevaluation of the zoonotic risk of CWD. <***

***> All animals have variable signs of prion neuropathology in spinal cords and brains and by supersensitive IHC, reaction was detected in spinal cord segments of all animals.<*** 

***> In particular the US data do not clearly exclude the possibility of human (sporadic or familial) TSE development due to consumption of venison. The Working Group thus recognizes a potential risk to consumers if a TSE would be present in European cervids.'' Scientific opinion on chronic wasting disease (II) <***


North American and Norwegian Chronic Wasting Disease prions exhibit different potential for interspecies transmission and zoonotic risk

Sandra Pritzkow1,*, Damian Gorski1,*, Frank Ramirez1 , Glenn C. Telling2 , Sylvie L. Benestad3 and Claudio Soto1,#

1 Mitchell Center for Alzheimer's disease and related Brain disorders, Department of Neurology, University of Texas McGovern Medical School at Houston, Texas, USA 2 Prion Research Center, Department of Microbiology, Immunology and Pathology, Colorado State University, Fort Collins, Colorado, USA 3 Norwegian Veterinary Institute, OIE Reference Laboratory for CWD, Oslo, Norway.

Summary: We investigated the in vitro spillover and zoonotic potential of CWD from various cervid species. Our results suggest that Norway CWD prions have a higher potential to infect other animals, but NorthAmerican CWD appear more prone to generate human prions.

The current evidence for CWD transmission to humans is controversial; indeed, while transgenic mice expressing human PrP did not develop disease when challenged with CWD prions in various laboratories [6-8, 41], experimental inoculation of CWD into squirrel monkeys produced disease [9, 10]. Studies in macaques, which are phylogenetically closer to humans than squirrel monkeys [45] have shown mixed results. A study from Czub and colleagues found that CWD prions can induce disease and pathologic abnormalities typical of prion disease in macaques exposed to CWD prions, even by oral inoculation of muscle tissue from cervids affected by CWD [46]. However, a different study found no evidence for prion disease in macaques inoculated with CWD [47]. To assess the cervid/human species barrier, we previously used PMCA to determine prion replication in vitro. We found that, after stabilization by successive passages in deer PrPC, PrPSc from CWD infected deer can convert human PrPC into a novel form of PrPSc [13]. Our current study to evaluate in vitro zoonotic potential of various CWD prions showed that although the cervid/human barrier is large, we were able to observe generation of human PrPSc with some specific CWD strains in a second round of PMCA (Fig. 5). The three North American CWD isolates were capable to sustain generation of human PrPSc, with white-tailed deer showing the highest efficiency. Conversely, none of the three Norway CWD isolates generated any detectable PrPSc signal up to the second round of PMCA. This data suggest that North American CWD prions might be of a greater risk to humans than the infected animals in Northern Europe. We speculate that these differences might be due to Norwegian CWD being less stable prion strains as compared to North American CWD, which have had longer time to replicate in cervids and become stabilized through many rounds of natural infection. Our findings may provide important information to understand the diversity of natural CWD prion strains in different animals across distinct geographical areas and their consequences for the spillover into other animal species, including humans.


MONDAY, JULY 19, 2021 

U Calgary researchers at work on a vaccine against a fatal infectious disease affecting deer and potentially people


TUESDAY, JULY 13, 2021

Chronic Wasting Disease and the Canadian Agriculture and Agri-food Sectors Current Knowledge Risks and Policy Options

''The science is progressing on the possibility of transmission of CWD to humans through oral transmission, but the complete assessment of this possibility remains to be done.''


MONDAY, DECEMBER 16, 2019 

Chronic Wasting Disease CWD TSE Prion aka mad cow type disease in cervid Zoonosis Update

***> ''In particular the US data do not clearly exclude the possibility of human (sporadic or familial) TSE development due to consumption of venison. The Working Group thus recognizes a potential risk to consumers if a TSE would be present in European cervids.'' Scientific opinion on chronic wasting disease (II) <***

What if?


TUESDAY, MAY 11, 2021 
 
A Unique Presentation of Creutzfeldt-Jakob Disease in a Patient Consuming Deer Antler Velvet

Conclusion

We believe that our patient’s case of CJD is highly suspicious for cervid etiology given the circumstances of the case as well as the strong evidence of plausibility reported in published literature. This is the first known case of CJD in a patient who had consumed deer antler velvet. Despite the confirmed diagnosis of CJD, a causal relationship between the patient’s disease and his consumption of deer antler velvet cannot be definitively concluded.

Supplemental data including molecular tissue sample analysis and autopsy findings could yield further supporting evidence. Given this patient’s clinical resemblance to CBD and the known histological similarities of CBD with CJD, clinicians should consider both diseases in the differential diagnosis of patients with a similarly esoteric presentation. Regardless of the origin of this patient’s disease, it is clear that the potential for prion transmission from cervids to humans should be further investigated by the academic community with considerable urgency. 


''We believe that our patient’s case of CJD is highly suspicious for cervid etiology given the circumstances of the case as well as the strong evidence of plausibility reported in published literature. This is the first known case of CJD in a patient who had consumed deer antler velvet. Despite the confirmed diagnosis of CJD, a causal relationship between the patient’s disease and his consumption of deer antler velvet cannot be definitively concluded.''
 

ABOUT that deer antler spray and CWD TSE PRION...
 
I have been screaming this since my neighbors mom died from cjd, and she had been taking a supplement that contained bovine brain, bovine eyeball, and other SRMs specified risk materials, the most high risk for mad cow disease.
just saying...
 
I made a submission to the BSE Inquiry long ago during the BSE Inquiry days, and they seemed pretty interested.
 
Sender: "Patricia Cantos"
 
To: "Terry S Singeltary Sr. (E-mail)"
 
Subject: Your submission to the Inquiry
 
Date: Fri, 3 Jul 1998 10:10:05 +0100
 
3 July 1998
 
Mr Terry S Singeltary Sr.
 
E-Mail: Flounder at wt.net
 
Ref: E2979
 
Dear Mr Singeltary,
 
Thank you for your E-mail message of the 30th of June 1998 providing the Inquiry with your further comments.
 
Thank you for offering to provide the Inquiry with any test results on the nutritional supplements your mother was taking before she died.
 
As requested I am sending you our general Information Pack and a copy of the Chairman's letter. Please contact me if your system cannot read the attachments.
 
Regarding your question, the Inquiry is looking into many aspects of the scientific evidence on BSE and nvCJD. I would refer you to the transcripts of evidence we have already heard which are found on our internet site at ;
 
 
Could you please provide the Inquiry with a copy of the press article you refer to in your e-mail? If not an approximate date for the article so that we can locate it?
 
In the meantime, thank you for you comments. Please do not hesitate to contact me on...
 
snip...end...tss
 
everyone I tell this too gets it screwed up...MY MOTHER WAS NOT TAKING THOSE SUPPLEMENTS IPLEX (that I ever knew of). this was my neighbors mother that died exactly one year _previously_ and to the day of sporadic CJD that was diagnosed as Alzheimer’s at first. my mother died exactly a year later from the Heidenhain Variant of Creutzfeldt Jakob Disease hvCJD, and exceedingly rare strains of the ever growing sporadic CJD’s. _both_ cases confirmed. ...kind regards, terry
 
TSEs i.e. mad cow disease's BSE/BASE and NUTRITIONAL SUPPLEMENTS
 
IPLEX, mad by standard process;
 
vacuum dried bovine BRAIN, bone meal, bovine EYE, veal Bone, bovine liver powder, bovine adrenal, vacuum dried bovine kidney, and vacuum dried porcine stomach.
 
also;
 
what about potential mad cow candy bars ?
 
see their potential mad cow candy bar list too...
 
THESE are just a few of MANY of just this ONE COMPANY...TSS
 
DEPARTMENT OF HEALTH AND HUMAN SERVICES
 
FOOD AND DRUG ADMINISTRATION CENTER FOR BIOLOGICS EVALUATION AND RESEARCH
 
TRANSMISSIBLE SPONGIFORM ENCEPHALOPATHIES ADVISORY COMMITTEE
 
Friday, January 19, 2001 snip...
 
17 But I think that we could exhibit some quite
 
18 reasonable concern about blood donors who are taking dietary
 
19 supplements that contain a certain amount of unspecified-
 
20 origin brain, brain-related, brain and pituitary material.
 
21 If they have done this for more than a sniff or something
 
22 like that, then, perhaps, they should be deferred as blood
 
23 donors.
 
24 That is probably worse than spending six months in
 
25 the U.K.
 
1/19/01
 
3681t2.rtf(845) page 501
 
 
 
 
see full text ;
 

Saturday, May 1, 2021 

Clinical Use of Improved Diagnostic Testing for Detection of Prion Disease

 ***Moreover, sporadic disease has never been observed in breeding colonies or primate research laboratories, most notably among hundreds of animals over several decades of study at the National Institutes of Health25, and in nearly twenty older animals continuously housed in our own facility.***

Even if the prevailing view is that sporadic CJD is due to the spontaneous formation of CJD prions, it remains possible that its apparent sporadic nature may, at least in part, result from our limited capacity to identify an environmental origin.

https://www.nature.com/articles/srep11573 

O.05: Transmission of prions to primates after extended silent incubation periods: Implications for BSE and scrapie risk assessment in human populations 
Emmanuel Comoy, Jacqueline Mikol, Valerie Durand, Sophie Luccantoni, Evelyne Correia, Nathalie Lescoutra, Capucine Dehen, and Jean-Philippe Deslys Atomic Energy Commission; Fontenay-aux-Roses, France 

Prion diseases (PD) are the unique neurodegenerative proteinopathies reputed to be transmissible under field conditions since decades. The transmission of Bovine Spongiform Encephalopathy (BSE) to humans evidenced that an animal PD might be zoonotic under appropriate conditions. Contrarily, in the absence of obvious (epidemiological or experimental) elements supporting a transmission or genetic predispositions, PD, like the other proteinopathies, are reputed to occur spontaneously (atpical animal prion strains, sporadic CJD summing 80% of human prion cases). 

Non-human primate models provided the first evidences supporting the transmissibiity of human prion strains and the zoonotic potential of BSE. Among them, cynomolgus macaques brought major information for BSE risk assessment for human health (Chen, 2014), according to their phylogenetic proximity to humans and extended lifetime. We used this model to assess the zoonotic potential of other animal PD from bovine, ovine and cervid origins even after very long silent incubation periods. 

*** We recently observed the direct transmission of a natural classical scrapie isolate to macaque after a 10-year silent incubation period, 

***with features similar to some reported for human cases of sporadic CJD, albeit requiring fourfold long incubation than BSE. Scrapie, as recently evoked in humanized mice (Cassard, 2014), 

***is the third potentially zoonotic PD (with BSE and L-type BSE), 

***thus questioning the origin of human sporadic cases. 

We will present an updated panorama of our different transmission studies and discuss the implications of such extended incubation periods on risk assessment of animal PD for human health. 

=============== 

***thus questioning the origin of human sporadic cases*** 

=============== 

***our findings suggest that possible transmission risk of H-type BSE to sheep and human. Bioassay will be required to determine whether the PMCA products are infectious to these animals. 

============== 

https://prion2015.files.wordpress.com/2015/05/prion2015abstracts.pdf 

***Transmission data also revealed that several scrapie prions propagate in HuPrP-Tg mice with efficiency comparable to that of cattle BSE. While the efficiency of transmission at primary passage was low, subsequent passages resulted in a highly virulent prion disease in both Met129 and Val129 mice. 

***Transmission of the different scrapie isolates in these mice leads to the emergence of prion strain phenotypes that showed similar characteristics to those displayed by MM1 or VV2 sCJD prion. 

***These results demonstrate that scrapie prions have a zoonotic potential and raise new questions about the possible link between animal and human prions. 

http://www.tandfonline.com/doi/abs/10.1080/19336896.2016.1163048?journalCode=kprn20 

PRION 2016 TOKYO

Saturday, April 23, 2016

SCRAPIE WS-01: Prion diseases in animals and zoonotic potential 2016

Prion. 10:S15-S21. 2016 ISSN: 1933-6896 printl 1933-690X online

Taylor & Francis

Prion 2016 Animal Prion Disease Workshop Abstracts

WS-01: Prion diseases in animals and zoonotic potential

Transmission of the different scrapie isolates in these mice leads to the emergence of prion strain phenotypes that showed similar characteristics to those displayed by MM1 or VV2 sCJD prion. 

These results demonstrate that scrapie prions have a zoonotic potential and raise new questions about the possible link between animal and human prions. 

http://www.tandfonline.com/doi/abs/10.1080/19336896.2016.1163048?journalCode=kprn20

Title: Transmission of scrapie prions to primate after an extended silent incubation period) 

*** In complement to the recent demonstration that humanized mice are susceptible to scrapie, we report here the first observation of direct transmission of a natural classical scrapie isolate to a macaque after a 10-year incubation period. Neuropathologic examination revealed all of the features of a prion disease: spongiform change, neuronal loss, and accumulation of PrPres throughout the CNS. 

*** This observation strengthens the questioning of the harmlessness of scrapie to humans, at a time when protective measures for human and animal health are being dismantled and reduced as c-BSE is considered controlled and being eradicated. 

*** Our results underscore the importance of precautionary and protective measures and the necessity for long-term experimental transmission studies to assess the zoonotic potential of other animal prion strains. 

http://www.ars.usda.gov/research/publications/publications.htm?SEQ_NO_115=313160

3.2.1.2 Non‐cervid domestic species

The remarkably high rate of natural CWD transmission in the ongoing NA epidemics raises the question of the risk to livestock grazing on CWD‐contaminated shared rangeland and subsequently developing a novel CWD‐related prion disease. This issue has been investigated by transmitting CWD via experimental challenge to cattle, sheep and pigs and to tg mouse lines expressing the relevant species PrP.

For cattle challenged with CWD, PrPSc was detected in approximately 40% of intracerebrally inoculated animals (Hamir et al., 2005, 2006a, 2007). Tg mice expressing bovine PrP have also been challenged with CWD and while published studies have negative outcomes (Tamguney et al., 2009b), unpublished data provided for the purposes of this Opinion indicate that some transmission of individual isolates to bovinised mice is possible (Table 1).

In small ruminant recipients, a low rate of transmission was reported between 35 and 72 months post‐infection (mpi) in ARQ/ARQ and ARQ/VRQ sheep intracerebrally challenged with mule deer CWD (Hamir et al., 2006b), while two out of two ARQ/ARQ sheep intracerebrally inoculated with elk CWD developed clinical disease after 28 mpi (Madsen‐Bouterse et al., 2016). However, tg mice expressing ARQ sheep PrP were resistant (Tamguney et al., 2006) and tg mice expressing the VRQ PrP allele were poorly susceptible to clinical disease (Beringue et al., 2012; Madsen‐Bouterse et al., 2016). In contrast, tg mice expressing VRQ sheep PrP challenged with CWD have resulted in highly efficient, life‐long asymptomatic replication of these prions in the spleen tissue (Beringue et al., 2012).

A recent study investigated the potential for swine to serve as hosts of the CWD agent(s) by intracerebral or oral challenge of crossbred piglets (Moore et al., 2016b, 2017). Pigs sacrificed at 6 mpi, approximately the age at which pigs reach market weight, were clinically healthy and negative by diagnostic tests, although low‐level CWD agent replication could be detected in the CNS by bioassay in tg cervinised mice. Among pigs that were incubated for up to 73 mpi, some gave diagnostic evidence of CWD replication in the brain between 42 and 72 mpi. Importantly, this was observed also in one orally challenged pig at 64 mpi and the presence of low‐level CWD replication was confirmed by mouse bioassay. The authors of this study argued that pigs can support low‐level amplification of CWD prions, although the species barrier to CWD infection is relatively high and that the detection of infectivity in orally inoculated pigs with a mouse bioassay raises the possibility that naturally exposed pigs could act as a reservoir of CWD infectivity.




1: J Infect Dis 1980 Aug;142(2):205-8

Oral transmission of kuru, Creutzfeldt-Jakob disease, and scrapie to nonhuman primates.

Gibbs CJ Jr, Amyx HL, Bacote A, Masters CL, Gajdusek DC.

Kuru and Creutzfeldt-Jakob disease of humans and scrapie disease of sheep and goats were transmitted to squirrel monkeys (Saimiri sciureus) that were exposed to the infectious agents only by their nonforced consumption of known infectious tissues. The asymptomatic incubation period in the one monkey exposed to the virus of kuru was 36 months; that in the two monkeys exposed to the virus of Creutzfeldt-Jakob disease was 23 and 27 months, respectively; and that in the two monkeys exposed to the virus of scrapie was 25 and 32 months, respectively. Careful physical examination of the buccal cavities of all of the monkeys failed to reveal signs or oral lesions. One additional monkey similarly exposed to kuru has remained asymptomatic during the 39 months that it has been under observation.

snip...

The successful transmission of kuru, Creutzfeldt-Jakob disease, and scrapie by natural feeding to squirrel monkeys that we have reported provides further grounds for concern that scrapie-infected meat may occasionally give rise in humans to Creutzfeldt-Jakob disease.

PMID: 6997404


Recently the question has again been brought up as to whether scrapie is transmissible to man. This has followed reports that the disease has been transmitted to primates. One particularly lurid speculation (Gajdusek 1977) conjectures that the agents of scrapie, kuru, Creutzfeldt-Jakob disease and transmissible encephalopathy of mink are varieties of a single "virus". The U.S. Department of Agriculture concluded that it could "no longer justify or permit scrapie-blood line and scrapie-exposed sheep and goats to be processed for human or animal food at slaughter or rendering plants" (ARC 84/77)" The problem is emphasised by the finding that some strains of scrapie produce lesions identical to the once which characterise the human dementias"

Whether true or not. the hypothesis that these agents might be transmissible to man raises two considerations. First, the safety of laboratory personnel requires prompt attention. Second, action such as the "scorched meat" policy of USDA makes the solution of the scrapie problem urgent if the sheep industry is not to suffer grievously.

snip...

76/10.12/4.6


Nature. 1972 Mar 10;236(5341):73-4.

Transmission of scrapie to the cynomolgus monkey (Macaca fascicularis).

Gibbs CJ Jr, Gajdusek DC.

Nature 236, 73 - 74 (10 March 1972); doi:10.1038/236073a0

Transmission of Scrapie to the Cynomolgus Monkey (Macaca fascicularis)

C. J. GIBBS jun. & D. C. GAJDUSEK

National Institute of Neurological Diseases and Stroke, National Institutes of Health, Bethesda, Maryland

SCRAPIE has been transmitted to the cynomolgus, or crab-eating, monkey (Macaca fascicularis) with an incubation period of more than 5 yr from the time of intracerebral inoculation of scrapie-infected mouse brain. The animal developed a chronic central nervous system degeneration, with ataxia, tremor and myoclonus with associated severe scrapie-like pathology of intensive astroglial hypertrophy and proliferation, neuronal vacuolation and status spongiosus of grey matter. The strain of scrapie virus used was the eighth passage in Swiss mice (NIH) of a Compton strain of scrapie obtained as ninth intracerebral passage of the agent in goat brain, from Dr R. L. Chandler (ARC, Compton, Berkshire).



Wednesday, February 16, 2011

IN CONFIDENCE

SCRAPIE TRANSMISSION TO CHIMPANZEES

IN CONFIDENCE

reference...

RB3.20

TRANSMISSION TO CHIMPANZEES

1. Kuru and CJD have been successfully transmitted to chimpanzees but scrapie and TME have not.

2. We cannot say that scrapie will not transmit to chimpanzees. There are several scrapie strains and I am not aware that all have been tried (that would have to be from mouse passaged material). Nor has a wide enough range of field isolates subsequently strain typed in mice been inoculated by the appropriate routes (i/c, ilp and i/v) :

3. I believe the proposed experiment to determine transmissibility, if conducted, would only show the susceptibility or resistance of the chimpanzee to infection/disease by the routes used and the result could not be interpreted for the predictability of the susceptibility for man. Proposals for prolonged oral exposure of chimpanzees to milk from cattle were suggested a long while ago and rejected.

4. In view of Dr Gibbs' probable use of chimpazees Mr Wells' comments (enclosed) are pertinent. I have yet to receive a direct communication from Dr Schellekers but before any collaboration or provision of material we should identify the Gibbs' proposals and objectives.

5. A positive result from a chimpanzee challenged severely would likely create alarm in some circles even if the result could not be interpreted for man. I have a view that all these agents could be transmitted provided a large enough dose by appropriate routes was given and the animals kept long enough. Until the mechanisms of the species barrier are more clearly understood it might be best to retain that hypothesis.

6. A negative result would take a lifetime to determine but that would be a shorter period than might be available for human exposure and it would still not answer the question regarding mans' susceptibility. In the meantime no doubt the negativity would be used defensively. It would however be counterproductive if the experiment finally became positive. We may learn more about public reactions following next Monday' s meeting.

R. Bradley

23 September 1990

CVO (+Mr Wells' comments)

Dr T W A Little

Dr B J Shreeve

90/9.23/1.1.


IN CONFIDENCE CHIMPANZEES

CODE 18-77 Reference RB3.46

Some further information that may assist in decision making has been gained by discussion with Dr Rosalind Ridley.

She says that careful study of Gajdusek's work shows no increased susceptibility of chimpanzees over New World Monkeys such as Squirrel Monkeys. She does not think it would tell you anything about the susceptibility to man. Also Gajdusek did not, she believes, challenge chimpanzees with scrapie as severely as we did pigs and we know little of that source of scrapie. Comparisons would be difficult. She also would not expect the Home Office to sanction such experiments here unless there was a very clear and important objective that would be important for human health protection. She doubted such a case could be made. If this is the case she thought it would be unethical to do an experiment abroad because we could not do it in our own country.

Retrospectively she feels they should have put up more marmosets than they did. They all remain healthy. They would normally regard the transmission as negative if no disease resulted in five years.

We are not being asked for a decision but I think that before we made one we should gain as much knowledge as we can. If we decided to proceed we would have to bear any criticisms for many years if there was an adverse view by scientists or­media. This should not be undertaken lightly. There is already some adverse comment here, I gather, on the pig experiment though that will subside.

The Gibbs' (as' distinct from Schellekers') study is somewhat different. We are merely supplying material for comparative studies in a laboratory with the greatest experience of human SEs in the world and it has been sanctioned by USDA (though we do not know for certain yet if chimpanzees specifically will be used). This would keep it at a lower profile than if we conducted such an experiment in the UK or Europe.

I consider we must have very powerful and defendable objectives to go beyond Gibbs' proposed experiments and should not initiate others just because an offer has been made.

Scientists have a responsibility to seek other methods of investigative research other than animal experimentation. At present no objective has convinced me we need to do research using Chimpanzees - a species in need of protection. Resisting such proposals would enable us to communicate that information to the scientist and the public should the need arise. A line would have been drawn.

CVO cc Dr T Dr B W A Little Dr B J Shreeve

R Bradley

26 September 1990

90/9.26/3.2


this is tse prion political theater here, i.e. what i call TSE PRION POKER...tss



3. Prof. A. Robertson gave a brief account of BSE. The US approach was to accord it a very low profile indeed. Dr. A Thiermann showed the picture in the ''Independent'' with cattle being incinerated and thought this was a fanatical incident to be avoided in the US at all costs.

snip...

PAGE 26

Transmission Studies

Mule deer transmissions of CWD were by intracerebral inoculation and compared with natural cases {the following was written but with a single line marked through it ''first passage (by this route)}....TSS

resulted in a more rapidly progressive clinical disease with repeated episodes of synocopy ending in coma. One control animal became affected, it is believed through contamination of inoculum (?saline). Further CWD transmissions were carried out by Dick Marsh into ferret, mink and squirrel monkey. Transmission occurred in ALL of these species with the shortest incubation period in the ferret.

The occurrence of CWD must be viewed against the contest of the locations in which it occurred. It was an incidental and unwelcome complication of the respective wildlife research programmes. Despite its subsequent recognition as a new disease of cervids, therefore justifying direct investigation, no specific research funding was forthcoming. The USDA veiwed it as a wildlife problem and consequently not their province! ...page 26. 

snip...see;

IN CONFIDENCE

PERCEPTIONS OF UNCONVENTIONAL SLOW VIRUS DISEASE OF ANIMALS IN THE USA

GAH WELLS

REPORT OF A VISIT TO THE USA

APRIL-MAY 1989


Thursday, July 29, 2021 

TSE PRION OCCUPATIONAL EXPOSURE VIA ANIMAL OR HUMAN, iatrogenic transmission, nvCJD or sCJD, what if? 

Sunday, January 10, 2021 

APHIS Concurrence With OIE Risk Designation for Bovine Spongiform Encephalopathy [Docket No. APHIS-2018-0087] Singeltary Submission June 17, 2019

APHIS Concurrence With OIE Risk Designation for Bovine Spongiform Encephalopathy [Docket No. APHIS-2018-0087] Singeltary Submission

Greetings APHIS et al, 

I would kindly like to comment on APHIS Concurrence With OIE Risk Designation for Bovine Spongiform Encephalopathy [Docket No. APHIS-2018-0087], and my comments are as follows, with the latest peer review and transmission studies as references of evidence.

THE OIE/USDA BSE Minimal Risk Region MRR is nothing more than free pass to import and export the Transmissible Spongiform Encephalopathy TSE Prion disease. December 2003, when the USDA et al lost it's supposedly 'GOLD CARD' ie BSE FREE STATUS (that was based on nothing more than not looking and not finding BSE), once the USA lost it's gold card BSE Free status, the USDA OIE et al worked hard and fast to change the BSE Geographical Risk Statuses i.e. the BSE GBR's, and replaced it with the BSE MRR policy, the legal tool to trade mad cow type disease TSE Prion Globally. The USA is doing just what the UK did, when they shipped mad cow disease around the world, except with the BSE MRR policy, it's now legal. 

Also, the whole concept of the BSE MRR policy is based on a false pretense, that atypical BSE is not transmissible, and that only typical c-BSE is transmissible via feed. This notion that atypical BSE TSE Prion is an old age cow disease that is not infectious is absolutely false, there is NO science to show this, and on the contrary, we now know that atypical BSE will transmit by ORAL ROUTES, but even much more concerning now, recent science has shown that Chronic Wasting Disease CWD TSE Prion in deer and elk which is rampant with no stopping is sight in the USA, and Scrapie TSE Prion in sheep and goat, will transmit to PIGS by oral routes, this is our worst nightmare, showing even more risk factors for the USA FDA PART 589 TSE PRION FEED ban. 

The FDA PART 589 TSE PRION FEED ban has failed terribly bad, and is still failing, since August 1997. there is tonnage and tonnage of banned potential mad cow feed that went into commerce, and still is, with one decade, 10 YEARS, post August 1997 FDA PART 589 TSE PRION FEED ban, 2007, with 10,000,000 POUNDS, with REASON, Products manufactured from bulk feed containing blood meal that was cross contaminated with prohibited meat and bone meal and the labeling did not bear cautionary BSE statement. you can see all these feed ban warning letters and tonnage of mad cow feed in commerce, year after year, that is not accessible on the internet anymore like it use to be, you can see history of the FDA failure August 1997 FDA PART 589 TSE PRION FEED ban here, but remember this, we have a new outbreak of TSE Prion disease in a new livestock species, the camel, and this too is very worrisome.

WITH the OIE and the USDA et al weakening the global TSE prion surveillance, by not classifying the atypical Scrapie as TSE Prion disease, and the notion that they want to do the same thing with typical scrapie and atypical BSE, it's just not scientific.

WE MUST abolish the BSE MRR policy, go back to the BSE GBR risk assessments by country, and enhance them to include all strains of TSE Prion disease in all species. With Chronic Wasting CWD TSE Prion disease spreading in Europe, now including, Norway, Finland, Sweden, also in Korea, Canada and the USA, and the TSE Prion in Camels, the fact the the USA is feeding potentially CWD, Scrapie, BSE, typical and atypical, to other animals, and shipping both this feed and or live animals or even grains around the globe, potentially exposed or infected with the TSE Prion. this APHIS Concurrence With OIE Risk Designation for Bovine Spongiform Encephalopathy [Docket No. APHIS-2018-0087], under it's present definition, does NOT show the true risk of the TSE Prion in any country. as i said, it's nothing more than a legal tool to trade the TSE Prion around the globe, nothing but ink on paper.

AS long as the BSE MRR policy stays in effect, TSE Prion disease will continued to be bought and sold as food for both humans and animals around the globe, and the future ramifications from friendly fire there from, i.e. iatrogenic exposure and transmission there from from all of the above, should not be underestimated. ... 





WEDNESDAY, MARCH 24, 2021 

USDA Animal and Plant Health Inspection Service 2020 IMPACT REPORT BSE TSE Prion Testing and Surveillance MIA


WEDNESDAY, DECEMBER 2, 2020

EFSA Evaluation of public and animal health risks in case of a delayed post-mortem inspection in ungulates EFSA Panel on Biological Hazards (BIOHAZ) ADOPTED: 21 October 2020

i wonder if a 7 month delay on a suspect BSE case in Texas is too long, on a 48 hour turnaround, asking for a friend???


MONDAY, NOVEMBER 30, 2020 

***> REPORT OF THE MEETING OF THE OIE SCIENTIFIC COMMISSION FOR ANIMAL DISEASES Paris, 9–13 September 2019 BSE, TSE, PRION

see updated concerns with atypical BSE from feed and zoonosis...terry


WEDNESDAY, DECEMBER 23, 2020 

BSE research project final report 2005 to 2008 SE1796 SID5


***> Wednesday, January 23, 2019 

***> CFIA SFCR Guidance on Specified risk material (SRM) came into force on January 15, 2019 <***


TUESDAY, JANUARY 5, 2021 

Exploration of genetic factors resulting in abnormal disease in cattle experimentally challenged with bovine spongiform encephalopathy


*** Singeltary reply ; Molecular, Biochemical and Genetic Characteristics of BSE in Canada Singeltary reply ;


IBNC Tauopathy or TSE Prion disease, it appears, no one is sure 

Terry S. Singeltary Sr., 03 Jul 2015 at 16:53 GMT

PLOS ONE Journal 

IBNC Tauopathy or TSE Prion disease, it appears, no one is sure 

Terry S. Singeltary Sr., 03 Jul 2015 at 16:53 GMT

***however in 1 C-type challenged animal, Prion 2015 Poster Abstracts S67 PrPsc was not detected using rapid tests for BSE.

***Subsequent testing resulted in the detection of pathologic lesion in unusual brain location and PrPsc detection by PMCA only.

*** IBNC Tauopathy or TSE Prion disease, it appears, no one is sure ***


THURSDAY, AUGUST 19, 2021 

TME to cattle equal atypical L-type BSE USA, madcow origin, what if?


MAD CAMEL DISEASE OR CPD CAMEL PRION DISEASE
Tuesday, April 27, 2021 

Working Document on Camel Prion Disease (CPrD) 14/09/2020



Owens, Julie

From: Terry S. Singeltary Sr. [flounder9@verizon.net]

Sent: Monday, July 24, 2006 1:09 PM

To: FSIS Regulations Comments

Subject: [Docket No. FSIS-2006-0011] FSIS Harvard Risk Assessment of Bovine Spongiform Encephalopathy (BSE)

Page 1 of 98

8/3/2006

Greetings FSIS,

I would kindly like to comment on the following ;


MONDAY, NOVEMBER 16, 2015

Docket No. APHIS-2007-0127 Scrapie in Sheep and Goats Terry Singeltary Sr. Submission

Docket No. APHIS-2007-0127 Scrapie in Sheep and Goats Terry Singeltary Sr. Submission Docket No. APHIS-2007-0127 

Scrapie in Sheep and Goats SUMMARY: We are reopening the comment period for our proposed rule that would revise completely the scrapie regulations, which concern the risk groups and categories established for individual animals and for flocks, the use of genetic testing as a means of assigning risk levels to animals, movement restrictions for animals found to be genetically less susceptible or resistant to scrapie, and record keeping requirements. This action will allow interested persons additional time to prepare and submit comments. DATES: The comment period for the proposed rule published on September 10, 2015 (80 FR 54660-54692) is reopened. We will consider all comments that we receive on or before December 9, 2015. ... 




JAMA.2001; 285: 733-734. Vol. 285 No. 6, February 14, 2001 JAMA 

Diagnosis and Reporting of Creutzfeldt-Jakob Disease Singeltary, Sr et al. 

JAMA.2001; 285: 733-734. Vol. 285 No. 6, February 14, 2001 JAMA 

Diagnosis and Reporting of Creutzfeldt-Jakob Disease 

To the Editor: In their Research Letter, Dr Gibbons and colleagues1 reported that the annual US death rate due to Creutzfeldt-Jakob disease (CJD) has been stable since 1985. These estimates, however, are based only on reported cases, and do not include misdiagnosed or preclinical cases. It seems to me that misdiagnosis alone would drastically change these figures. An unknown number of persons with a diagnosis of Alzheimer disease in fact may have CJD, although only a small number of these patients receive the postmortem examination necessary to make this diagnosis. Furthermore, only a few states have made CJD reportable. Human and animal transmissible spongiform encephalopathies should be reportable nationwide and internationally.. 

Terry S. Singeltary, Sr Bacliff, Tex 1. Gibbons RV, Holman RC, Belay ED, Schonberger LB. Creutzfeldt-Jakob disease in the United States: 1979-1998. JAMA. 2000;284:2322-2323. 


RE-Monitoring the occurrence of emerging forms of Creutzfeldt-Jakob disease in the United States

Terry S. Singeltary, retired (medically), CJD WATCH

Submitted March 26, 2003

I lost my mother to hvCJD (Heidenhain Variant CJD). I would like to comment on the CDC's attempts to monitor the occurrence of emerging forms of CJD. Asante, Collinge et al [1] have reported that BSE transmission to the 129-methionine genotype can lead to an alternate phenotype that is indistinguishable from type 2 PrPSc, the commonest sporadic CJD. However, CJD and all human TSEs are not reportable nationally. CJD and all human TSEs must be made reportable in every state and internationally. I hope that the CDC does not continue to expect us to still believe that the 85%+ of all CJD cases which are sporadic are all spontaneous, without route/source. We have many TSEs in the USA in both animal and man. CWD in deer/elk is spreading rapidly and CWD does transmit to mink, ferret, cattle, and squirrel monkey by intracerebral inoculation. With the known incubation periods in other TSEs, oral transmission studies of CWD may take much longer. Every victim/family of CJD/TSEs should be asked about route and source of this agent. To prolong this will only spread the agent and needlessly expose others. In light of the findings of Asante and Collinge et al, there should be drastic measures to safeguard the medical and surgical arena from sporadic CJDs and all human TSEs. I only ponder how many sporadic CJDs in the USA are type 2 PrPSc?

SPORADIC CJD LAYING ODDS


In brief

BMJ 2000; 320 doi: https://doi.org/10.1136/bmj.320.7226.8/b (Published 01 January 2000)

Cite this as: BMJ 2000;320:8

Rapid Response:

02 January 2000

Terry S Singeltary

retired

U.S. Scientist should be concerned with a CJD epidemic in the U.S., as well... In reading your short article about 'Scientist warn of CJD epidemic' news in brief Jan. 1, 2000. I find the findings in the PNAS old news, made famous again. Why is the U.S. still sitting on their butts, ignoring the facts? We have the beginning of a CJD epidemic in the U.S., and the U.S. Gov. is doing everything in it's power to conceal it.

The exact same recipe for B.S.E. existed in the U.S. for years and years. In reading over the Qualitative Analysis of BSE Risk Factors-1, this is a 25 page report by the USDA:APHIS:VS. It could have been done in one page. The first page, fourth paragraph says it all;

"Similarities exist in the two countries usage of continuous rendering technology and the lack of usage of solvents, however, large differences still remain with other risk factors which greatly reduce the potential risk at the national level."

Then, the next 24 pages tries to down-play the high risks of B.S.E. in the U.S., with nothing more than the cattle to sheep ratio count, and the geographical locations of herds and flocks. That's all the evidence they can come up with, in the next 24 pages.

Something else I find odd, page 16;

"In the United Kingdom there is much concern for a specific continuous rendering technology which uses lower temperatures and accounts for 25 percent of total output. This technology was _originally_ designed and imported from the United States. However, the specific application in the production process is _believed_ to be different in the two countries."

A few more factors to consider, page 15;

"Figure 26 compares animal protein production for the two countries. The calculations are based on slaughter numbers, fallen stock estimates, and product yield coefficients. This approach is used due to variation of up to 80 percent from different reported sources. At 3.6 million tons, the United States produces 8 times more animal rendered product than the United Kingdom."

"The risk of introducing the BSE agent through sheep meat and bone meal is more acute in both relative and absolute terms in the United Kingdom (Figures 27 and 28). Note that sheep meat and bone meal accounts for 14 percent, or 61 thousand tons, in the United Kingdom versus 0.6 percent or 22 thousand tons in the United States. For sheep greater than 1 year, this is less than one-tenth of one percent of the United States supply."

"The potential risk of amplification of the BSE agent through cattle meat and bone meal is much greater in the United States where it accounts for 59 percent of total product or almost 5 times more than the total amount of rendered product in the United Kingdom."

Considering, it would only take _one_ scrapie infected sheep to contaminate the feed. Considering Scrapie has run rampant in the U.S. for years, as of Aug. 1999, 950 scrapie infected flocks. Also, Considering only one quarter spoonful of scrapie infected material is lethal to a cow.

Considering all this, the sheep to cow ration is meaningless. As I said, it's 24 pages of B.S.e.

To be continued...

Terry S. Singeltary Sr.

Bacliff, Texas USA

Competing interests: No competing interests


Rapid response to:

US scientists develop a possible test for BSE

15 November 1999

Terry S Singeltary

NA

BMJ 1999; 319 doi: https://doi.org/10.1136/bmj.319.7220.1312b (Published 13 November 1999)

Cite this as: BMJ 1999;319:1312

Article Related content Article metrics 

Rapid responses 

Response Rapid Response: Re: vCJD in the USA * BSE in U.S. In reading the recent article in the BMJ about the potential BSE tests being developed in the U.S. and Bart Van Everbroeck reply. It does not surprize me, that the U.S. has been concealing vCJD. There have been people dying from CJD, with all the symptoms and pathological findings that resemble U.K. vCJD for some time. It just seems that when there is one found, they seem to change the clarical classification of the disease, to fit their agenda. I have several autopsies, stating kuru type amyloid plaques, one of the victims was 41 years of age. Also, my Mom died a most hideous death, Heidenhain Variant Creutzfeldt Jakob disease. Her symptoms resemble that of all the U.K. vCJD victims. She would jerk so bad at times, it would take 3 of us to hold her down, while she screamed "God, what's wrong with me, why can't I stop this." 1st of symptoms to death, 10 weeks, she went blind in the first few weeks. But, then they told me that this was just another strain of sporadic CJD. They can call it what ever they want, but I know what I saw, and what she went through. Sporadic, simply means, they do not know. My neighbors Mom also died from CJD. She had been taking a nutritional supplement which contained the following; vacuum dried bovine BRAIN, bone meal, bovine EYE, veal bone, bovine liver powder, bovine adrenal, vacuum dried bovine kidney, and vacuum dried porcine stomach. As I said, this woman taking these nutritional supplements, died from CJD. The particular batch of pills that was located, in which she was taking, was tested. From what I have heard, they came up negative, for the prion protein. But, in the same breath, they said their testing, may not have been strong enough to pick up the infectivity. Plus, she had been taking these type pills for years, so, could it have come from another batch?

CWD is just a small piece of a very big puzzle. I have seen while deer hunting, deer, squirrels and birds, eating from cattle feed troughs where they feed cattle, the high protein cattle by products, at least up until Aug. 4, 1997.

So why would it be so hard to believe that this is how they might become infected with a TSE. Or, even by potentially infected land. It's been well documented that it could be possible, from scrapie. Cats becoming infected with a TSE. Have you ever read the ingredients on the labels of cat and dog food? But, they do not put these tissues from these animals in pharmaceuticals, cosmetics, nutritional supplements, hGH, hPG, blood products, heart valves, and the many more products that come from bovine, ovine, or porcine tissues and organs. So, as I said, this CWD would be a small piece of a very big puzzle. But, it is here, and it most likely has killed. You see, greed is what caused this catastrophe, rendering and feeding practices. But, once Pandora's box was opened, the potential routes of infection became endless.

No BSE in the U.S.A.? I would not be so sure of that considering that since 1990;

Since 1990 the U.S. has raised 1,250,880,700 cattle;

Since 1990 the U.S. has ONLY checked 8,881 cattle brains for BSE, as of Oct. 4, 1999;

There are apprx. 100,000 DOWNER cattle annually in the U.S., that up until Aug. 4, 1997 went to the renders for feed;

Scrapie running rampant for years in the U.S., 950 infected FLOCKS, as of Aug. 1999;

Our feeding and rendering practices have mirrored that of the U.K. for years, some say it was worse. Everything from the downer cattle, to those scrapie infected sheep, to any roadkill, including the city police horse and the circus elephant went to the renders for feed and other products for consumption. Then they only implemented a partial feed ban on Aug. 4, 1997, but pigs, chickens, dogs, and cats, and humans were exempt from that ban. So they can still feed pigs and chickens those potentially TSE tainted by-products, and then they can still feed those by-products back to the cows. I believe it was Dr. Joe Gibbs, that said, the prion protein, can survive the digestinal track. So you have stopped nothing. It was proven in Oprah Winfrey's trial, that Cactus Cattle feeders, sent neurologically ill cattle, some with encephalopathy stamped on the dead slips, were picked up and sent to the renders, along with sheep carcasses. Speaking of autopsies, I have a stack of them, from CJD victims. You would be surprised of the number of them, who ate cow brains, elk brains, deer brains, or hog brains.

I believe all these TSE's are going to be related, and originally caused by the same greedy Industries, and they will be many. Not just the Renders, but you now see, that they are re-using medical devices that were meant for disposal. Some medical institutions do not follow proper auto- claving procedures (even Olympus has put out a medical warning on their endescopes about CJD, and the fact you cannot properly clean these instruments from TSE's), and this is just one product. Another route of infection.

Regardless what the Federal Government in the U.S. says. It's here, I have seen it, and the longer they keep sweeping it under the rug and denying the fact that we have a serious problem, one that could surpass aids (not now, but in the years to come, due to the incubation period), they will be responsible for the continued spreading of this deadly disease.

It's their move, it's CHECK, but once CHECKMATE has been called, how many thousands or millions, will be at risk or infected or even dead. You can't play around with these TSE's. I cannot stress that enough. They are only looking at body bags, and the fact the count is so low. But, then you have to look at the fact it is not a reportable disease in most states, mis-diagnosis, no autopsies performed. The fact that their one-in-a- million theory is a crude survey done about 5 years ago, that's a joke, under the above circumstances. A bad joke indeed........

The truth will come, but how many more have to die such a hideous death. It's the Government's call, and they need to make a serious move, soon. This problem, potential epidemic, is not going away, by itself.

Terry S. Singeltary Sr.

Bacliff, Texas 77518 USA


Competing interests: No competing interests


TUESDAY, AUGUST 03, 2021 

USA Tables of Cases Examined National Prion Disease Pathology Surveillance Center Cases Examined July 9th, 2021


Wednesday, July 28, 2021 

France issues moratorium on prion research after fatal brain disease strikes two lab workers


Thursday, July 29, 2021 

TSE PRION OCCUPATIONAL EXPOSURE VIA ANIMAL OR HUMAN, iatrogenic transmission, nvCJD or sCJD, what if? 


Terry S. Singeltary Sr.

0 Comments:

Post a Comment

Subscribe to Post Comments [Atom]

<< Home